Incidental Mutation 'R7661:Mindy3'
ID591548
Institutional Source Beutler Lab
Gene Symbol Mindy3
Ensembl Gene ENSMUSG00000026767
Gene NameMINDY lysine 48 deubiquitinase 3
Synonyms5830410F13Rik, 2310047O13Rik, 1810041E18Rik, Fam188a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location12347263-12419470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12397517 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 208 (I208K)
Ref Sequence ENSEMBL: ENSMUSP00000028105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028105] [ENSMUST00000124515] [ENSMUST00000124603] [ENSMUST00000129489] [ENSMUST00000129993] [ENSMUST00000144645] [ENSMUST00000151529] [ENSMUST00000154899] [ENSMUST00000155530]
Predicted Effect probably damaging
Transcript: ENSMUST00000028105
AA Change: I208K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028105
Gene: ENSMUSG00000026767
AA Change: I208K

DomainStartEndE-ValueType
DUF4205 9 351 1.48e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124515
SMART Domains Protein: ENSMUSP00000120193
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Blast:DUF4205 9 94 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124603
SMART Domains Protein: ENSMUSP00000117457
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 79 8.3e-12 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121265
Gene: ENSMUSG00000026767
AA Change: I114K

DomainStartEndE-ValueType
DUF4205 3 160 3.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129489
SMART Domains Protein: ENSMUSP00000122501
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 84 9.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129993
SMART Domains Protein: ENSMUSP00000141479
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 3 87 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144645
SMART Domains Protein: ENSMUSP00000116836
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 87 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151529
Predicted Effect probably benign
Transcript: ENSMUST00000154899
SMART Domains Protein: ENSMUSP00000121476
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 1 110 6.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155530
SMART Domains Protein: ENSMUSP00000116939
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 9 135 6.24e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a caspase-associated recruitment domain and may function in apoptosis. It has been identified as a tumor suppressor in lung and gastric cancers, and a polymorphism in the gene may be associated with gastric cancer risk. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Mindy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Mindy3 APN 2 12355272 splice site probably benign
IGL02623:Mindy3 APN 2 12364483 nonsense probably null
R0944:Mindy3 UTSW 2 12396182 missense possibly damaging 0.94
R1275:Mindy3 UTSW 2 12396173 splice site probably null
R2066:Mindy3 UTSW 2 12419249 missense probably damaging 1.00
R2232:Mindy3 UTSW 2 12404045 missense probably benign 0.44
R2357:Mindy3 UTSW 2 12404176 splice site probably benign
R3724:Mindy3 UTSW 2 12355354 missense probably damaging 0.97
R4031:Mindy3 UTSW 2 12401083 splice site probably null
R4089:Mindy3 UTSW 2 12364516 missense probably benign 0.21
R4175:Mindy3 UTSW 2 12405865 missense probably damaging 1.00
R4359:Mindy3 UTSW 2 12396209 missense probably damaging 1.00
R4424:Mindy3 UTSW 2 12348199 missense probably benign 0.00
R4640:Mindy3 UTSW 2 12348163 missense probably benign 0.01
R4931:Mindy3 UTSW 2 12396213 missense probably damaging 1.00
R5926:Mindy3 UTSW 2 12348100 missense probably damaging 1.00
R5966:Mindy3 UTSW 2 12401043 missense probably benign 0.17
R6330:Mindy3 UTSW 2 12356933 missense probably damaging 1.00
R6518:Mindy3 UTSW 2 12382129 missense probably damaging 1.00
R6587:Mindy3 UTSW 2 12348116 nonsense probably null
R6852:Mindy3 UTSW 2 12419252 start codon destroyed possibly damaging 0.53
R6961:Mindy3 UTSW 2 12396178 critical splice donor site probably null
R7103:Mindy3 UTSW 2 12401074 missense possibly damaging 0.95
R7624:Mindy3 UTSW 2 12419189 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCATCACTGGCCACACAC -3'
(R):5'- TTCATAGAGCCCATGAGTGAGAATG -3'

Sequencing Primer
(F):5'- ACACACAGCACGCACTG -3'
(R):5'- AAAGGAATCTTTGGGGGCTACTTC -3'
Posted On2019-11-12