Incidental Mutation 'R7661:Pygo2'
ID591550
Institutional Source Beutler Lab
Gene Symbol Pygo2
Ensembl Gene ENSMUSG00000047824
Gene Namepygopus 2
Synonyms1190004M21Rik, mpygo2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7661 (G1)
Quality Score190.009
Status Not validated
Chromosome3
Chromosomal Location89430214-89435128 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 89430731 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039110] [ENSMUST00000060061] [ENSMUST00000094378] [ENSMUST00000107413] [ENSMUST00000107417] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000137793] [ENSMUST00000191485]
Predicted Effect probably benign
Transcript: ENSMUST00000039110
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060061
SMART Domains Protein: ENSMUSP00000053672
Gene: ENSMUSG00000047824

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Blast:SH2 52 78 1e-9 BLAST
low complexity region 115 163 N/A INTRINSIC
low complexity region 177 193 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
PHD 328 382 3.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094378
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107413
SMART Domains Protein: ENSMUSP00000103036
Gene: ENSMUSG00000047824

DomainStartEndE-ValueType
Blast:SH2 15 41 1e-9 BLAST
low complexity region 78 126 N/A INTRINSIC
low complexity region 140 156 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
low complexity region 272 287 N/A INTRINSIC
PHD 291 345 3.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107417
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125036
SMART Domains Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 1 155 1.5e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128238
SMART Domains Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 144 7.7e-19 PFAM
Pfam:PID 134 190 7.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137793
SMART Domains Protein: ENSMUSP00000117190
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191485
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, have small or absent lens, abnormal optic cup morphology, and impaired mammary gland epithelium proliferation. Mice homozygous for a knock-in allele exhibit normal development and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Pygo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Pygo2 APN 3 89432446 unclassified probably benign
R0147:Pygo2 UTSW 3 89433303 missense probably damaging 1.00
R0330:Pygo2 UTSW 3 89433154 missense possibly damaging 0.72
R2046:Pygo2 UTSW 3 89433148 missense possibly damaging 0.72
R4093:Pygo2 UTSW 3 89433264 missense probably damaging 0.98
R5341:Pygo2 UTSW 3 89432760 missense probably damaging 0.98
R7172:Pygo2 UTSW 3 89432636 missense probably benign 0.23
R7386:Pygo2 UTSW 3 89432821 missense probably benign 0.18
R8043:Pygo2 UTSW 3 89432928 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAACGGCTCTGTGCTTTC -3'
(R):5'- TTCAGTGTCATCCAAAACCTGAAG -3'

Sequencing Primer
(F):5'- CTAGGGCTTGCTGCTGCTC -3'
(R):5'- AACCTGAAGTGTTCTGTGACACC -3'
Posted On2019-11-12