Incidental Mutation 'R7661:Pigg'
ID591558
Institutional Source Beutler Lab
Gene Symbol Pigg
Ensembl Gene ENSMUSG00000029263
Gene Namephosphatidylinositol glycan anchor biosynthesis, class G
SynonymsGpi7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108312609-108349355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108338619 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 713 (V713I)
Ref Sequence ENSEMBL: ENSMUSP00000113818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031189] [ENSMUST00000118910] [ENSMUST00000119014]
Predicted Effect probably benign
Transcript: ENSMUST00000031189
AA Change: V705I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031189
Gene: ENSMUSG00000029263
AA Change: V705I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 68 314 6.3e-15 PFAM
transmembrane domain 428 450 N/A INTRINSIC
transmembrane domain 463 482 N/A INTRINSIC
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 540 562 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 688 705 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
transmembrane domain 785 802 N/A INTRINSIC
transmembrane domain 876 898 N/A INTRINSIC
transmembrane domain 911 933 N/A INTRINSIC
transmembrane domain 948 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118910
AA Change: V580I

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112984
Gene: ENSMUSG00000029263
AA Change: V580I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SCOP:d1eqja2 127 202 8e-8 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 338 357 N/A INTRINSIC
transmembrane domain 372 394 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
transmembrane domain 563 580 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 624 641 N/A INTRINSIC
transmembrane domain 660 677 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 786 808 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119014
AA Change: V713I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113818
Gene: ENSMUSG00000029263
AA Change: V713I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 164 286 2.2e-9 PFAM
transmembrane domain 436 458 N/A INTRINSIC
transmembrane domain 471 490 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 548 570 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 793 810 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
transmembrane domain 919 941 N/A INTRINSIC
transmembrane domain 956 975 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in glycosylphosphatidylinositol-anchor biosynthesis. The encoded protein, which is localized to the endoplasmic reticulum, is involved in transferring ethanoloamine phosphate to mannose 2 of glycosylphosphatidylinositol species H7 to form species H8. Allelic variants of this gene have been associated with intellectual disability, hypotonia, and early-onset seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Pigg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Pigg APN 5 108342078 missense probably damaging 1.00
IGL01308:Pigg APN 5 108336477 missense probably damaging 1.00
IGL01485:Pigg APN 5 108336201 missense possibly damaging 0.90
IGL02043:Pigg APN 5 108344324 missense probably damaging 1.00
IGL02104:Pigg APN 5 108342097 missense probably damaging 1.00
IGL02238:Pigg APN 5 108318928 missense possibly damaging 0.64
IGL02311:Pigg APN 5 108336380 missense probably benign
IGL02608:Pigg APN 5 108313003 missense probably damaging 0.98
IGL03338:Pigg APN 5 108319950 missense probably damaging 1.00
P0033:Pigg UTSW 5 108342078 missense probably damaging 1.00
R0082:Pigg UTSW 5 108312885 start gained probably benign
R0449:Pigg UTSW 5 108336411 missense probably benign 0.00
R0616:Pigg UTSW 5 108314085 missense probably damaging 1.00
R1246:Pigg UTSW 5 108341820 missense probably damaging 0.99
R1368:Pigg UTSW 5 108317288 missense probably damaging 1.00
R1777:Pigg UTSW 5 108317391 missense probably damaging 1.00
R1898:Pigg UTSW 5 108336542 missense probably benign
R2022:Pigg UTSW 5 108312922 start gained probably benign
R2037:Pigg UTSW 5 108338652 missense probably damaging 1.00
R2157:Pigg UTSW 5 108318889 missense probably damaging 1.00
R2181:Pigg UTSW 5 108336500 missense probably damaging 0.96
R2291:Pigg UTSW 5 108332917 missense probably damaging 0.97
R3157:Pigg UTSW 5 108314148 missense probably damaging 1.00
R4117:Pigg UTSW 5 108348042 missense probably benign 0.15
R4572:Pigg UTSW 5 108332885 missense probably benign 0.27
R4589:Pigg UTSW 5 108332690 missense probably benign
R5019:Pigg UTSW 5 108332149 missense probably damaging 1.00
R5094:Pigg UTSW 5 108336257 missense possibly damaging 0.90
R5329:Pigg UTSW 5 108314160 missense probably damaging 0.99
R5960:Pigg UTSW 5 108336294 missense probably benign 0.01
R5976:Pigg UTSW 5 108332191 missense probably null 1.00
R6089:Pigg UTSW 5 108341922 missense probably benign
R6797:Pigg UTSW 5 108332828 missense probably damaging 0.99
R6960:Pigg UTSW 5 108326841 missense probably damaging 0.98
R7090:Pigg UTSW 5 108336512 missense possibly damaging 0.92
R7659:Pigg UTSW 5 108338619 missense probably benign 0.03
R7660:Pigg UTSW 5 108338619 missense probably benign 0.03
R7732:Pigg UTSW 5 108318975 missense probably benign 0.00
R7749:Pigg UTSW 5 108336296 missense probably benign
R7765:Pigg UTSW 5 108314054 missense probably benign 0.00
R8021:Pigg UTSW 5 108319939 missense probably damaging 1.00
R8268:Pigg UTSW 5 108338643 missense probably damaging 0.99
R8320:Pigg UTSW 5 108347851 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGTGAATGAGATCTCAGTATGG -3'
(R):5'- TGGCACGGCATTGTTAGTACAG -3'

Sequencing Primer
(F):5'- GATCTCAGTATGGTAATCTTTGTGAC -3'
(R):5'- CGGCATTGTTAGTACAGAAACAC -3'
Posted On2019-11-12