Incidental Mutation 'R7661:Nanog'
ID591564
Institutional Source Beutler Lab
Gene Symbol Nanog
Ensembl Gene ENSMUSG00000012396
Gene NameNanog homeobox
Synonyms2410002E02Rik, ecat4, ENK
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location122707489-122714633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122713472 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 279 (R279W)
Ref Sequence ENSEMBL: ENSMUSP00000012540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012540] [ENSMUST00000112580] [ENSMUST00000112581]
PDB Structure
CRYSTAL STRUCTURE OF THE NANOG HOMEODOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000012540
AA Change: R279W

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000012540
Gene: ENSMUSG00000012396
AA Change: R279W

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
HOX 96 158 5.33e-22 SMART
low complexity region 206 230 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112580
AA Change: R254W

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108199
Gene: ENSMUSG00000012396
AA Change: R254W

DomainStartEndE-ValueType
HOX 71 133 5.33e-22 SMART
low complexity region 181 205 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112581
AA Change: R254W

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108200
Gene: ENSMUSG00000012396
AA Change: R254W

DomainStartEndE-ValueType
HOX 71 133 5.33e-22 SMART
low complexity region 181 205 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: The protein encoded by this gene is a DNA binding homeobox transcription factor involved in embryonic stem (ES) cell proliferation, renewal, and pluripotency. The encoded protein can block ES cell differentiation and can also autorepress its own expression in differentiating cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene die between E3.5 and E5.5 with abnormal embryonic and extraembryonic tissue development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Nanog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Nanog APN 6 122711536 critical splice acceptor site probably null
IGL03278:Nanog APN 6 122711745 missense probably damaging 1.00
IGL03387:Nanog APN 6 122711772 missense probably damaging 1.00
R0280:Nanog UTSW 6 122713398 missense probably damaging 0.96
R1443:Nanog UTSW 6 122711775 missense probably damaging 1.00
R2520:Nanog UTSW 6 122713459 missense probably benign 0.08
R3037:Nanog UTSW 6 122713268 missense possibly damaging 0.81
R4486:Nanog UTSW 6 122712717 critical splice donor site probably null
R4770:Nanog UTSW 6 122711591 missense possibly damaging 0.63
R4790:Nanog UTSW 6 122707915 missense probably benign 0.00
R4825:Nanog UTSW 6 122713340 missense probably benign 0.09
R4931:Nanog UTSW 6 122707906 missense possibly damaging 0.95
R6010:Nanog UTSW 6 122713296 missense probably benign 0.16
R6025:Nanog UTSW 6 122713391 missense possibly damaging 0.94
R8236:Nanog UTSW 6 122713172 missense probably benign
R8272:Nanog UTSW 6 122711777 missense probably benign 0.00
X0065:Nanog UTSW 6 122707793 missense probably benign
Z1176:Nanog UTSW 6 122713231 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGACCAACCCAACTTGGA -3'
(R):5'- GTCTCCAAAGCCTAGAGTTAACA -3'

Sequencing Primer
(F):5'- CCCAACTTGGAGCAGCC -3'
(R):5'- TGCAGAGAAACCCTGTCTTG -3'
Posted On2019-11-12