Incidental Mutation 'R7661:Capza3'
ID591565
Institutional Source Beutler Lab
Gene Symbol Capza3
Ensembl Gene ENSMUSG00000041791
Gene Namecapping protein (actin filament) muscle Z-line, alpha 3
SynonymsGsg3, repro32, 510-4, Tex8, cp alpha3, Cappa3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location140041252-140042778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140041772 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 32 (D32E)
Ref Sequence ENSEMBL: ENSMUSP00000038562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032356] [ENSMUST00000043797] [ENSMUST00000129986] [ENSMUST00000137148] [ENSMUST00000149931]
Predicted Effect probably benign
Transcript: ENSMUST00000032356
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043797
AA Change: D32E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038562
Gene: ENSMUSG00000041791
AA Change: D32E

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 12 278 7.3e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Predicted Effect probably benign
Transcript: ENSMUST00000149931
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin capping protein, one of the F-actin capping protein alpha subunit family. The encoded protein is predominantly localized to the neck region of ejaculated sperm, other immunohistochemical signals were found in the tail and postacrosomal regions. The encoded protein may also form heterodimers of alpha and beta subunits. This protein may be important in determining sperm architecture and male fertility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for an ENU-induced mutation are infertile, exhibit low epididymal sperm concentrations, and produce sperm with abnormally shaped heads and poor motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Capza3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Capza3 APN 6 140042146 missense probably benign
IGL02228:Capza3 APN 6 140041915 missense probably benign
R1953:Capza3 UTSW 6 140042568 missense possibly damaging 0.59
R4272:Capza3 UTSW 6 140042538 missense probably benign 0.33
R4278:Capza3 UTSW 6 140042060 nonsense probably null
R4421:Capza3 UTSW 6 140042042 missense probably benign
R5504:Capza3 UTSW 6 140042439 missense probably benign 0.42
R7070:Capza3 UTSW 6 140041920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAATGGGCAAGGTATCCC -3'
(R):5'- TGGATATCCCTCAGTTGATTCTGG -3'

Sequencing Primer
(F):5'- AAGGTATCCCATGGACCGTTTTC -3'
(R):5'- CAGTTGATTCTGGAGTAGGTCAAACC -3'
Posted On2019-11-12