Incidental Mutation 'R7661:Gm9268'
ID591567
Institutional Source Beutler Lab
Gene Symbol Gm9268
Ensembl Gene ENSMUSG00000091528
Gene Namepredicted gene 9268
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7661 (G1)
Quality Score163.009
Status Not validated
Chromosome7
Chromosomal Location43018798-43048106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43023158 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 72 (N72K)
Ref Sequence ENSEMBL: ENSMUSP00000129068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166914] [ENSMUST00000173815]
Predicted Effect probably benign
Transcript: ENSMUST00000166914
AA Change: N72K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129068
Gene: ENSMUSG00000091528
AA Change: N72K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 473 1.1e-41 PFAM
Pfam:NCD3G 516 569 1.7e-23 PFAM
Pfam:7tm_3 602 837 9.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173815
AA Change: N72K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134441
Gene: ENSMUSG00000091528
AA Change: N72K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 5.3e-40 PFAM
Pfam:NCD3G 509 562 4.6e-22 PFAM
Pfam:7tm_3 594 831 1.1e-73 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Gm9268
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Gm9268 APN 7 43024709 missense probably damaging 0.97
IGL01753:Gm9268 APN 7 43024715 missense probably damaging 1.00
IGL02338:Gm9268 APN 7 43047736 missense probably damaging 1.00
IGL02541:Gm9268 APN 7 43023668 splice site probably benign
R0751:Gm9268 UTSW 7 43047409 missense probably damaging 0.99
R0849:Gm9268 UTSW 7 43024718 missense probably damaging 1.00
R1460:Gm9268 UTSW 7 43023215 missense probably benign 0.25
R1617:Gm9268 UTSW 7 43024079 missense probably benign 0.18
R1962:Gm9268 UTSW 7 43047400 missense probably benign 0.00
R1999:Gm9268 UTSW 7 43047459 missense probably damaging 1.00
R2022:Gm9268 UTSW 7 43024030 missense probably benign
R2434:Gm9268 UTSW 7 43047457 missense probably damaging 0.99
R3760:Gm9268 UTSW 7 43024078 missense probably benign 0.00
R4562:Gm9268 UTSW 7 43023562 nonsense probably null
R4890:Gm9268 UTSW 7 43047600 missense probably damaging 1.00
R5221:Gm9268 UTSW 7 43023260 missense probably benign 0.31
R5597:Gm9268 UTSW 7 43024649 missense probably benign 0.01
R6589:Gm9268 UTSW 7 43023598 missense possibly damaging 0.91
R6831:Gm9268 UTSW 7 43023580 missense probably damaging 1.00
R6834:Gm9268 UTSW 7 43023580 missense probably damaging 1.00
R6910:Gm9268 UTSW 7 43024051 missense probably benign 0.01
R6944:Gm9268 UTSW 7 43047969 missense possibly damaging 0.95
R7470:Gm9268 UTSW 7 43047886 missense probably damaging 1.00
R7553:Gm9268 UTSW 7 43048023 missense probably damaging 1.00
R7677:Gm9268 UTSW 7 43024739 missense probably damaging 1.00
R8087:Gm9268 UTSW 7 43047670 missense probably benign 0.04
R8210:Gm9268 UTSW 7 43024038 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTACATAACTTCAAGTGCCCATTCC -3'
(R):5'- CCCTGTGAGCCAAAGAAAGG -3'

Sequencing Primer
(F):5'- AACTTCAAGTGCCCATTCCAATTG -3'
(R):5'- TTGAACTCCTGACCTTCGGAAGAG -3'
Posted On2019-11-12