Incidental Mutation 'R7661:Olfr612'
ID591568
Institutional Source Beutler Lab
Gene Symbol Olfr612
Ensembl Gene ENSMUSG00000094119
Gene Nameolfactory receptor 612
SynonymsMOR15-3, GA_x6K02T2PBJ9-6251685-6250741, EG545985
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103537222-103542717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103538619 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 205 (V205E)
Ref Sequence ENSEMBL: ENSMUSP00000150524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104879] [ENSMUST00000214269] [ENSMUST00000215663]
Predicted Effect probably damaging
Transcript: ENSMUST00000104879
AA Change: V205E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100473
Gene: ENSMUSG00000094119
AA Change: V205E

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.3e-109 PFAM
Pfam:7TM_GPCR_Srsx 37 309 4.7e-11 PFAM
Pfam:7tm_1 43 294 3.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214269
AA Change: V205E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215663
AA Change: V205E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.2364 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Olfr612
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Olfr612 APN 7 103538574 missense probably damaging 1.00
IGL01901:Olfr612 APN 7 103538970 missense probably damaging 0.98
R1200:Olfr612 UTSW 7 103539067 missense probably benign 0.01
R1591:Olfr612 UTSW 7 103539067 missense probably benign 0.00
R1858:Olfr612 UTSW 7 103538652 missense probably damaging 1.00
R1975:Olfr612 UTSW 7 103538994 missense probably damaging 1.00
R1994:Olfr612 UTSW 7 103538359 missense possibly damaging 0.57
R3690:Olfr612 UTSW 7 103539067 missense probably benign 0.01
R4635:Olfr612 UTSW 7 103539148 missense probably benign 0.00
R4670:Olfr612 UTSW 7 103539186 missense possibly damaging 0.89
R5267:Olfr612 UTSW 7 103538824 missense probably benign 0.19
R5417:Olfr612 UTSW 7 103538763 missense possibly damaging 0.94
R6644:Olfr612 UTSW 7 103539058 missense possibly damaging 0.94
R7253:Olfr612 UTSW 7 103538788 missense probably benign 0.01
R7278:Olfr612 UTSW 7 103538728 missense probably benign 0.02
R7525:Olfr612 UTSW 7 103539131 nonsense probably null
R7553:Olfr612 UTSW 7 103539156 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTGGCCAGGGTCACATAG -3'
(R):5'- CTTGGCTATTGTTGTACGAACC -3'

Sequencing Primer
(F):5'- GCCTTGGACCAAAACGATG -3'
(R):5'- AACCTTAACTGTGCAGGTGC -3'
Posted On2019-11-12