Incidental Mutation 'R7661:Ick'
ID591571
Institutional Source Beutler Lab
Gene Symbol Ick
Ensembl Gene ENSMUSG00000009828
Gene Nameintestinal cell kinase
Synonyms2210420N10Rik
Accession Numbers

Genbank: NM_001163780, NM_019987

Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78109192-78172107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 78167620 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 586 (V586L)
Ref Sequence ENSEMBL: ENSMUSP00000048234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044551] [ENSMUST00000117330] [ENSMUST00000118869]
Predicted Effect probably benign
Transcript: ENSMUST00000044551
AA Change: V586L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048234
Gene: ENSMUSG00000009828
AA Change: V586L

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117330
SMART Domains Protein: ENSMUSP00000113655
Gene: ENSMUSG00000009828

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118869
AA Change: V586L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112961
Gene: ENSMUSG00000009828
AA Change: V586L

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal primary cilium morphology and Shh signaling during limb digit patterning, peripheral edema, cleft palate, hydrocephalus, polydactyly, delayed skeletal development, and embryonic lethality at late stages of gestation. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted, other(1) Gene trapped(28)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Ick
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ick APN 9 78164539 missense probably benign 0.00
IGL01679:Ick APN 9 78140025 missense possibly damaging 0.94
IGL02525:Ick APN 9 78160393 missense probably benign 0.37
IGL02719:Ick APN 9 78140019 missense probably damaging 0.99
BB001:Ick UTSW 9 78155464 missense probably damaging 1.00
BB011:Ick UTSW 9 78155464 missense probably damaging 1.00
H8930:Ick UTSW 9 78150619 missense possibly damaging 0.92
R0471:Ick UTSW 9 78155517 critical splice donor site probably null
R1626:Ick UTSW 9 78150637 missense probably damaging 1.00
R1824:Ick UTSW 9 78157862 missense probably benign
R2186:Ick UTSW 9 78131487 missense probably benign 0.07
R2872:Ick UTSW 9 78140100 splice site probably null
R2872:Ick UTSW 9 78140100 splice site probably null
R4609:Ick UTSW 9 78167789 utr 3 prime probably benign
R4737:Ick UTSW 9 78150654 missense probably damaging 1.00
R4792:Ick UTSW 9 78153693 missense probably damaging 1.00
R5001:Ick UTSW 9 78131519 missense probably damaging 1.00
R5060:Ick UTSW 9 78153696 missense probably benign 0.01
R5093:Ick UTSW 9 78140021 missense probably benign 0.24
R5393:Ick UTSW 9 78160715 missense probably benign
R6199:Ick UTSW 9 78164639 missense probably benign 0.04
R6412:Ick UTSW 9 78139976 missense probably damaging 1.00
R7038:Ick UTSW 9 78109202 unclassified probably benign
R7468:Ick UTSW 9 78157939 missense probably benign 0.00
R7660:Ick UTSW 9 78167620 missense probably benign
R7662:Ick UTSW 9 78167620 missense probably benign
R7666:Ick UTSW 9 78167620 missense probably benign
R7693:Ick UTSW 9 78157726 missense probably benign
R7783:Ick UTSW 9 78135645 missense probably damaging 0.97
R7787:Ick UTSW 9 78167620 missense probably benign
R7788:Ick UTSW 9 78167620 missense probably benign
R7924:Ick UTSW 9 78155464 missense probably damaging 1.00
R8317:Ick UTSW 9 78153651 missense probably damaging 0.98
X0067:Ick UTSW 9 78155403 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCCAGATGATAGAGTCTTCC -3'
(R):5'- GGTTGTTTTACACCGCCTCG -3'

Sequencing Primer
(F):5'- GCCAGATGATAGAGTCTTCCCACAG -3'
(R):5'- TACACCGCCTCGTGGTTGTG -3'
Posted On2019-11-12