Incidental Mutation 'R7661:Ascc1'
ID591578
Institutional Source Beutler Lab
Gene Symbol Ascc1
Ensembl Gene ENSMUSG00000044475
Gene Nameactivating signal cointegrator 1 complex subunit 1
Synonyms1810015P09Rik, ASC1p50, CGI-18
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location60002805-60099988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 60049807 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 227 (N227H)
Ref Sequence ENSEMBL: ENSMUSP00000052351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050516] [ENSMUST00000164083]
Predicted Effect probably damaging
Transcript: ENSMUST00000050516
AA Change: N227H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052351
Gene: ENSMUSG00000044475
AA Change: N227H

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 4.3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164083
AA Change: N227H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126301
Gene: ENSMUSG00000044475
AA Change: N227H

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 3e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the activating signal cointegrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene transactivation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The encoded protein contains an N-terminal KH-type RNA-binding motif which is required for AP-1 transactivation by the ASC-1 complex. Mutations in this gene are associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Ascc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Ascc1 APN 10 60012458 splice site probably benign
Dagger UTSW 10 60013653 missense probably damaging 1.00
stiletto UTSW 10 60004819 start codon destroyed probably damaging 1.00
R1307:Ascc1 UTSW 10 60012499 missense probably benign 0.00
R1463:Ascc1 UTSW 10 60062516 missense probably benign 0.17
R2403:Ascc1 UTSW 10 60004841 missense probably benign 0.20
R4308:Ascc1 UTSW 10 60013612 missense probably benign 0.00
R4703:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4704:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4705:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4916:Ascc1 UTSW 10 60004862 missense probably benign 0.01
R6906:Ascc1 UTSW 10 60004852 missense probably benign 0.01
R6944:Ascc1 UTSW 10 60013653 missense probably damaging 1.00
R7227:Ascc1 UTSW 10 60007738 missense probably benign 0.08
R7766:Ascc1 UTSW 10 60004819 start codon destroyed probably damaging 1.00
R8104:Ascc1 UTSW 10 60007729 missense probably benign
Z1176:Ascc1 UTSW 10 60007793 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGGACAGCTAGACTATGTTGCTG -3'
(R):5'- AACAGTCACAATCTGTCTTCTCTG -3'

Sequencing Primer
(F):5'- GCTAGACTATGTTGCTGGAAAAACCC -3'
(R):5'- CTGGTGCAAACATGGAATCCTAGTAC -3'
Posted On2019-11-12