Incidental Mutation 'R7661:Arid5b'
ID591579
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene NameAT rich interactive domain 5B (MRF1-like)
Synonyms5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt
Accession Numbers

Genbank: NM_023598; MGI: 2175912

Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location68092520-68278740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68098587 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 495 (G495E)
Ref Sequence ENSEMBL: ENSMUSP00000151227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218532
AA Change: G252E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219238
AA Change: G495E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 68128975 missense probably damaging 0.96
IGL01731:Arid5b APN 10 68097609 missense probably damaging 1.00
IGL02069:Arid5b APN 10 68097399 missense probably damaging 1.00
IGL02161:Arid5b APN 10 68096668 missense probably benign 0.00
IGL02555:Arid5b APN 10 68101904 missense probably benign 0.01
IGL02873:Arid5b APN 10 68101950 missense probably benign 0.06
IGL03119:Arid5b APN 10 68243227 missense probably damaging 1.00
IGL03271:Arid5b APN 10 68097457 missense possibly damaging 0.73
gobi UTSW 10 68118345 missense possibly damaging 0.92
3-1:Arid5b UTSW 10 68098589 missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 68098011 missense probably damaging 0.99
R0108:Arid5b UTSW 10 68278729 utr 5 prime probably benign
R0525:Arid5b UTSW 10 68097846 missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68186033 missense probably damaging 1.00
R0646:Arid5b UTSW 10 68096977 missense probably damaging 1.00
R1066:Arid5b UTSW 10 68098356 missense probably benign 0.04
R1487:Arid5b UTSW 10 68097214 nonsense probably null
R1638:Arid5b UTSW 10 68277947 missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68186067 missense probably damaging 0.99
R2031:Arid5b UTSW 10 68278688 critical splice donor site probably null
R2337:Arid5b UTSW 10 68097777 missense possibly damaging 0.63
R2996:Arid5b UTSW 10 68098462 missense probably benign 0.01
R2997:Arid5b UTSW 10 68098462 missense probably benign 0.01
R3547:Arid5b UTSW 10 68098462 missense probably benign 0.01
R4411:Arid5b UTSW 10 68096689 missense probably damaging 1.00
R4860:Arid5b UTSW 10 68243095 missense probably damaging 0.97
R4860:Arid5b UTSW 10 68243095 missense probably damaging 0.97
R5219:Arid5b UTSW 10 68278110 missense probably benign 0.08
R5341:Arid5b UTSW 10 68278127 missense possibly damaging 0.87
R5434:Arid5b UTSW 10 68096889 missense possibly damaging 0.67
R5757:Arid5b UTSW 10 68102079 missense probably damaging 1.00
R6114:Arid5b UTSW 10 68097744 missense possibly damaging 0.89
R6313:Arid5b UTSW 10 68097582 missense possibly damaging 0.95
R6338:Arid5b UTSW 10 68098561 nonsense probably null
R6525:Arid5b UTSW 10 68097666 missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68186212 nonsense probably null
R7013:Arid5b UTSW 10 68097819 missense probably damaging 1.00
R7099:Arid5b UTSW 10 68098179 missense probably damaging 1.00
R7260:Arid5b UTSW 10 68097807 missense probably damaging 1.00
R7324:Arid5b UTSW 10 68128922 missense probably benign 0.44
R7334:Arid5b UTSW 10 68243177 missense possibly damaging 0.61
R7432:Arid5b UTSW 10 68118266 missense probably damaging 1.00
R7453:Arid5b UTSW 10 68243164 missense probably benign 0.01
R7649:Arid5b UTSW 10 68118345 missense possibly damaging 0.92
R7659:Arid5b UTSW 10 68098587 missense probably benign
R7662:Arid5b UTSW 10 68098587 missense probably benign
R7663:Arid5b UTSW 10 68098587 missense probably benign
R7665:Arid5b UTSW 10 68098587 missense probably benign
R7666:Arid5b UTSW 10 68098587 missense probably benign
R7759:Arid5b UTSW 10 68097802 missense probably damaging 1.00
R7779:Arid5b UTSW 10 68096776 missense probably damaging 1.00
R7788:Arid5b UTSW 10 68098587 missense probably benign
R7789:Arid5b UTSW 10 68098587 missense probably benign
R7875:Arid5b UTSW 10 68128941 missense probably benign 0.02
R8079:Arid5b UTSW 10 68098356 missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68186152 missense probably benign 0.00
R8228:Arid5b UTSW 10 68278706 missense possibly damaging 0.95
X0066:Arid5b UTSW 10 68118302 missense probably damaging 1.00
Z1177:Arid5b UTSW 10 68097228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTGAGTCCATCTGGGTGC -3'
(R):5'- AAGCCTGGCTTCAAGGATAAC -3'

Sequencing Primer
(F):5'- CTGTTTGCCAGCCCCAG -3'
(R):5'- CCTGGCTTCAAGGATAACTGCTG -3'
Posted On2019-11-12