Incidental Mutation 'R7661:Blmh'
ID591582
Institutional Source Beutler Lab
Gene Symbol Blmh
Ensembl Gene ENSMUSG00000020840
Gene Namebleomycin hydrolase
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location76924809-76987379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76986515 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 419 (V419D)
Ref Sequence ENSEMBL: ENSMUSP00000021197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021197] [ENSMUST00000168124]
Predicted Effect probably damaging
Transcript: ENSMUST00000021197
AA Change: V419D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021197
Gene: ENSMUSG00000020840
AA Change: V419D

DomainStartEndE-ValueType
Pfam:Peptidase_C1_2 5 451 1.8e-210 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168124
SMART Domains Protein: ENSMUSP00000130370
Gene: ENSMUSG00000020840

DomainStartEndE-ValueType
Pfam:Peptidase_C1_2 5 70 4.1e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: The encoded protein is a cytoplasmic cysteine peptidase involved in inactivation of bleomycin, a glycopeptide which is a component of combination chemotherapy regimens for cancer. This encoded enzyme is highly conserved, and it contains the signature active site residues of cysteine protease papain superfamily enzymes. It is postulated that this enzyme has protective effects against bleomycin-induced pulmonary fibrosis and bleomycin tumor resistance. [provided by RefSeq, Jan 2010]
PHENOTYPE: About one-third of homozygous null mutants die neonatally; survivors develop variably penetrant tail dermatitis and pulmonary fibrosis following bleomycin treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Blmh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Blmh APN 11 76967013 missense probably damaging 1.00
IGL00661:Blmh APN 11 76965932 nonsense probably null
IGL02701:Blmh APN 11 76971910 missense probably benign 0.00
IGL03350:Blmh APN 11 76971948 missense probably damaging 1.00
R0570:Blmh UTSW 11 76965825 missense probably damaging 1.00
R1519:Blmh UTSW 11 76966781 missense probably damaging 1.00
R6724:Blmh UTSW 11 76971907 critical splice acceptor site probably null
R7054:Blmh UTSW 11 76968625 missense probably damaging 1.00
R7163:Blmh UTSW 11 76946161 missense unknown
R7215:Blmh UTSW 11 76965899 nonsense probably null
R7807:Blmh UTSW 11 76946214 missense probably benign 0.03
R7843:Blmh UTSW 11 76946313 missense probably damaging 1.00
R7895:Blmh UTSW 11 76945895 critical splice donor site probably null
R7926:Blmh UTSW 11 76946313 missense probably damaging 1.00
R7978:Blmh UTSW 11 76945895 critical splice donor site probably null
R8150:Blmh UTSW 11 76968629 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GTACAAGTCAGCACCACAGAGG -3'
(R):5'- AACTTTGGTTTCAGTCCCCGG -3'

Sequencing Primer
(F):5'- CACAGATTGCTAGTAAACTGGAGCTC -3'
(R):5'- GTTTCAGTCCCCGGGTCTG -3'
Posted On2019-11-12