Incidental Mutation 'R7661:Zfp839'
ID 591585
Institutional Source Beutler Lab
Gene Symbol Zfp839
Ensembl Gene ENSMUSG00000021271
Gene Name zinc finger protein 839
Synonyms 2810455K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7661 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 110850253-110869996 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110868792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 827 (T827I)
Ref Sequence ENSEMBL: ENSMUSP00000131841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043716] [ENSMUST00000170060] [ENSMUST00000220607] [ENSMUST00000221182] [ENSMUST00000222460]
AlphaFold E9PUU5
Predicted Effect probably benign
Transcript: ENSMUST00000043716
SMART Domains Protein: ENSMUSP00000035245
Gene: ENSMUSG00000021276

DomainStartEndE-ValueType
low complexity region 54 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170060
AA Change: T827I

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131841
Gene: ENSMUSG00000021271
AA Change: T827I

DomainStartEndE-ValueType
low complexity region 271 278 N/A INTRINSIC
ZnF_C2H2 295 320 3.02e0 SMART
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220607
Predicted Effect probably benign
Transcript: ENSMUST00000221182
Predicted Effect possibly damaging
Transcript: ENSMUST00000222460
AA Change: T751I

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Cldn20 T A 17: 3,532,858 M102K possibly damaging Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Other mutations in Zfp839
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp839 APN 12 110865007 critical splice donor site probably null
IGL00941:Zfp839 APN 12 110860948 missense probably damaging 1.00
R0013:Zfp839 UTSW 12 110868386 missense possibly damaging 0.66
R0013:Zfp839 UTSW 12 110868386 missense possibly damaging 0.66
R0109:Zfp839 UTSW 12 110860874 missense possibly damaging 0.92
R0116:Zfp839 UTSW 12 110858769 intron probably benign
R1219:Zfp839 UTSW 12 110868273 missense possibly damaging 0.63
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1434:Zfp839 UTSW 12 110860899 missense probably benign 0.08
R1653:Zfp839 UTSW 12 110855250 missense probably benign 0.02
R1754:Zfp839 UTSW 12 110855457 missense probably damaging 0.98
R2182:Zfp839 UTSW 12 110868338 missense probably damaging 1.00
R3765:Zfp839 UTSW 12 110855163 missense probably benign 0.22
R3981:Zfp839 UTSW 12 110866331 missense probably damaging 0.97
R4756:Zfp839 UTSW 12 110855201 missense possibly damaging 0.92
R5088:Zfp839 UTSW 12 110868176 missense probably damaging 0.99
R5394:Zfp839 UTSW 12 110855586 missense probably benign 0.05
R5619:Zfp839 UTSW 12 110864036 missense probably damaging 1.00
R6856:Zfp839 UTSW 12 110866761 nonsense probably null
R7860:Zfp839 UTSW 12 110855626 missense probably damaging 1.00
R8022:Zfp839 UTSW 12 110855098 missense probably damaging 1.00
R8855:Zfp839 UTSW 12 110868414 missense probably benign 0.06
R8866:Zfp839 UTSW 12 110868414 missense probably benign 0.06
R8896:Zfp839 UTSW 12 110868843 missense probably damaging 1.00
R9289:Zfp839 UTSW 12 110868444 missense probably benign 0.04
R9606:Zfp839 UTSW 12 110868342 missense probably benign
R9668:Zfp839 UTSW 12 110855846 missense probably damaging 0.98
R9686:Zfp839 UTSW 12 110855498 missense probably damaging 1.00
Z1177:Zfp839 UTSW 12 110866784 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCATAACACTGTGCCTGTG -3'
(R):5'- TCAAGAGCAACACCTTCTGG -3'

Sequencing Primer
(F):5'- AACACTGTGCCTGTGAACATCTTG -3'
(R):5'- TCAGGATAGAACCCCTTGCATTGG -3'
Posted On 2019-11-12