Incidental Mutation 'R0238:Dock4'
ID 59159
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 038476-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R0238 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 40787539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 818 (S818I)
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: S818I

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: S818I

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220912
AA Change: S818I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Meta Mutation Damage Score 0.4868 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,392,893 (GRCm39) V94G probably benign Het
Acp5 A T 9: 22,041,218 (GRCm39) S70T possibly damaging Het
Adcy1 C G 11: 7,089,162 (GRCm39) N525K possibly damaging Het
Adra1d C A 2: 131,388,134 (GRCm39) V474F probably benign Het
Aknad1 A G 3: 108,688,555 (GRCm39) M628V probably benign Het
Alg8 A T 7: 97,032,891 (GRCm39) probably null Het
Cacna1d A G 14: 29,845,453 (GRCm39) V572A probably benign Het
Ccdc158 A C 5: 92,809,977 (GRCm39) M177R probably benign Het
Ccdc191 A T 16: 43,767,859 (GRCm39) R678* probably null Het
Cdkn2d C A 9: 21,202,288 (GRCm39) probably benign Het
Cdx2 G T 5: 147,240,097 (GRCm39) T193K probably damaging Het
Cfap44 T A 16: 44,242,681 (GRCm39) M695K probably benign Het
Cfap70 A C 14: 20,498,673 (GRCm39) S5A probably benign Het
Chd9 T C 8: 91,659,456 (GRCm39) S139P probably damaging Het
Chmp7 A G 14: 69,958,446 (GRCm39) V241A probably damaging Het
Cnga1 A G 5: 72,762,374 (GRCm39) I380T probably damaging Het
Col4a1 C T 8: 11,268,780 (GRCm39) probably benign Het
Cts6 T A 13: 61,349,633 (GRCm39) E53D probably damaging Het
Cul2 A G 18: 3,414,115 (GRCm39) probably benign Het
Dclk3 A T 9: 111,311,696 (GRCm39) N646I probably damaging Het
Dnhd1 A G 7: 105,370,738 (GRCm39) S4673G probably benign Het
Dysf C T 6: 84,041,461 (GRCm39) Q156* probably null Het
Espnl T C 1: 91,250,009 (GRCm39) V52A probably damaging Het
Fam163b T C 2: 27,002,646 (GRCm39) N117S probably damaging Het
Fam89a A G 8: 125,467,971 (GRCm39) Y114H probably damaging Het
Flcn T C 11: 59,691,902 (GRCm39) N249S probably benign Het
Gnai1 A G 5: 18,478,548 (GRCm39) S206P probably damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Hal T C 10: 93,339,344 (GRCm39) S478P possibly damaging Het
Haus3 G A 5: 34,323,600 (GRCm39) P337S possibly damaging Het
Hectd1 T A 12: 51,816,101 (GRCm39) M1324L possibly damaging Het
Hpn G T 7: 30,798,815 (GRCm39) probably benign Het
Hspa9 A T 18: 35,079,699 (GRCm39) Y243* probably null Het
Htr3a T C 9: 48,817,686 (GRCm39) T96A probably benign Het
Ift140 C A 17: 25,264,497 (GRCm39) C557* probably null Het
Il4ra T C 7: 125,174,371 (GRCm39) probably benign Het
Ipo9 A G 1: 135,332,074 (GRCm39) probably benign Het
Irag2 G A 6: 145,117,704 (GRCm39) probably benign Het
Jph3 A G 8: 122,480,459 (GRCm39) Q379R possibly damaging Het
Kcnb1 A G 2: 166,946,889 (GRCm39) V653A probably benign Het
Kif14 A G 1: 136,455,131 (GRCm39) E1551G probably damaging Het
Krt17 G A 11: 100,151,704 (GRCm39) R30* probably null Het
Lamb3 A T 1: 193,003,361 (GRCm39) D100V probably damaging Het
Map2 A G 1: 66,455,265 (GRCm39) D1385G probably damaging Het
Map3k21 A G 8: 126,671,709 (GRCm39) D999G possibly damaging Het
Marf1 T C 16: 13,969,147 (GRCm39) I109V probably benign Het
Mcam T G 9: 44,051,502 (GRCm39) probably null Het
Med18 T C 4: 132,187,337 (GRCm39) H99R probably damaging Het
Mettl25 C T 10: 105,662,386 (GRCm39) V195I probably damaging Het
Micu2 G A 14: 58,154,835 (GRCm39) probably benign Het
Mpl A G 4: 118,314,060 (GRCm39) probably benign Het
Myh8 A G 11: 67,192,518 (GRCm39) T1466A probably benign Het
Myo1e A T 9: 70,249,408 (GRCm39) I503F possibly damaging Het
Myo3b T A 2: 69,935,769 (GRCm39) C61S probably benign Het
Myorg A T 4: 41,498,912 (GRCm39) N239K probably benign Het
Nbn T C 4: 15,986,672 (GRCm39) probably benign Het
Ndufa4 C T 6: 11,906,023 (GRCm39) V10I probably benign Het
Nf1 A T 11: 79,309,400 (GRCm39) K438M possibly damaging Het
Nlrp9c A G 7: 26,077,437 (GRCm39) S727P possibly damaging Het
Nmbr C T 10: 14,646,139 (GRCm39) Q338* probably null Het
Nt5e A G 9: 88,249,385 (GRCm39) S440G possibly damaging Het
Nubp2 T C 17: 25,103,445 (GRCm39) E144G probably damaging Het
Or12e7 T C 2: 87,288,381 (GRCm39) F291L probably benign Het
Or2ag1b A G 7: 106,288,462 (GRCm39) Y159H probably benign Het
Or52s1 G A 7: 102,861,933 (GRCm39) V289M possibly damaging Het
Otogl T A 10: 107,642,557 (GRCm39) N1291I probably damaging Het
Pa2g4 T C 10: 128,399,511 (GRCm39) K51R probably benign Het
Pah C T 10: 87,403,143 (GRCm39) P173S possibly damaging Het
Pcdhb12 A G 18: 37,569,780 (GRCm39) I309V probably benign Het
Pck1 T G 2: 172,998,861 (GRCm39) I373S possibly damaging Het
Pga5 A G 19: 10,646,817 (GRCm39) Y305H probably damaging Het
Plxnd1 G T 6: 115,945,754 (GRCm39) D906E probably benign Het
Ppfia4 T C 1: 134,256,927 (GRCm39) E98G possibly damaging Het
Pzp C T 6: 128,466,119 (GRCm39) probably benign Het
Rab39 G A 9: 53,617,330 (GRCm39) T29I probably damaging Het
Raet1e C A 10: 22,056,761 (GRCm39) H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 (GRCm39) Y252H probably damaging Het
Rars2 A C 4: 34,656,030 (GRCm39) Q421P probably benign Het
Rasa2 A T 9: 96,450,460 (GRCm39) D479E probably damaging Het
Rbl2 A T 8: 91,833,135 (GRCm39) T689S probably damaging Het
Rims4 C T 2: 163,705,945 (GRCm39) V230M probably benign Het
Scgb1b27 G A 7: 33,721,377 (GRCm39) probably benign Het
Sec31b G A 19: 44,513,908 (GRCm39) probably benign Het
Six3 G A 17: 85,928,818 (GRCm39) G51R probably damaging Het
Skp2 A C 15: 9,127,971 (GRCm39) probably null Het
Slc35f4 A T 14: 49,541,713 (GRCm39) I347N possibly damaging Het
Slc4a2 A T 5: 24,641,272 (GRCm39) probably null Het
Slc52a3 T C 2: 151,850,076 (GRCm39) *461Q probably null Het
Slc6a1 G A 6: 114,279,761 (GRCm39) V142I probably benign Het
Susd5 A G 9: 113,925,977 (GRCm39) *620W probably null Het
Timm21 T C 18: 84,965,791 (GRCm39) N239S probably damaging Het
Tmem131 T C 1: 36,867,131 (GRCm39) probably benign Het
Tmem63c T C 12: 87,122,413 (GRCm39) W404R probably damaging Het
Tnrc6b A G 15: 80,772,065 (GRCm39) D1118G probably damaging Het
Traf2 G C 2: 25,427,138 (GRCm39) A71G possibly damaging Het
Trim54 A G 5: 31,291,463 (GRCm39) M195V probably benign Het
Trip11 C T 12: 101,850,987 (GRCm39) E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,146,981 (GRCm39) probably benign Het
Trpm5 G T 7: 142,636,695 (GRCm39) T414N probably damaging Het
Vps51 G T 19: 6,121,467 (GRCm39) S185* probably null Het
Zfp329 G T 7: 12,544,756 (GRCm39) T256K probably damaging Het
Zfp729b A G 13: 67,740,022 (GRCm39) Y748H probably damaging Het
Zfp777 T C 6: 48,001,903 (GRCm39) E773G probably damaging Het
Zfp866 T C 8: 70,219,365 (GRCm39) Y53C probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTGCACAAAGGTTCTACCCTCAGG -3'
(R):5'- CTCTACAACAATGTGGGCAGGAGAC -3'

Sequencing Primer
(F):5'- GGTCCGATAAAAAAACTTGTGCC -3'
(R):5'- atcctgcgtcagcctcc -3'
Posted On 2013-07-11