Incidental Mutation 'R7661:Cldn20'
ID591592
Institutional Source Beutler Lab
Gene Symbol Cldn20
Ensembl Gene ENSMUSG00000091530
Gene Nameclaudin 20
SynonymsEG621628
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7661 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location3532554-3533213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3532858 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 102 (M102K)
Ref Sequence ENSEMBL: ENSMUSP00000126169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041003] [ENSMUST00000168560] [ENSMUST00000227405]
Predicted Effect probably benign
Transcript: ENSMUST00000041003
SMART Domains Protein: ENSMUSP00000035291
Gene: ENSMUSG00000036983

DomainStartEndE-ValueType
rADc 43 234 5.56e-69 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168560
AA Change: M102K

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126169
Gene: ENSMUSG00000091530
AA Change: M102K

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 8.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227405
Meta Mutation Damage Score 0.5412 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is identified in retinal pigment epithelium (RPE) and analysis of the RPE transcriptome reveals that this gene expression appears late during development of chick embryo. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik A T 12: 107,488,956 K100N unknown Het
9130019O22Rik A T 7: 127,384,963 C322* probably null Het
Abi3bp T A 16: 56,632,900 probably null Het
Akr1c20 T C 13: 4,508,219 D210G probably benign Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Ascc1 A C 10: 60,049,807 N227H probably damaging Het
Atp5a1 G T 18: 77,774,102 A18S possibly damaging Het
Bcl2l13 A G 6: 120,865,597 T84A possibly damaging Het
Blmh T A 11: 76,986,515 V419D probably damaging Het
Cacna1d G A 14: 30,047,220 P1918S probably benign Het
Calr4 T C 4: 109,253,754 V339A probably benign Het
Capza3 C A 6: 140,041,772 D32E probably benign Het
Dennd1a T C 2: 37,844,829 Q479R probably benign Het
Dpp10 A T 1: 123,384,952 I432N probably damaging Het
Dst T A 1: 34,256,353 probably null Het
Fam135a C T 1: 24,072,762 probably null Het
Fam47e C T 5: 92,587,525 L206F probably damaging Het
Focad G A 4: 88,303,535 R714H unknown Het
Gm11639 T A 11: 104,726,677 D741E probably benign Het
Gm5286 C T 3: 94,198,402 T9I probably damaging Het
Gm8693 A G 7: 22,691,804 S172P probably benign Het
Gm9268 T A 7: 43,023,158 N72K probably benign Het
Hace1 T G 10: 45,605,553 V124G probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifit1bl2 T A 19: 34,619,028 Y396F probably damaging Het
Il22ra2 A G 10: 19,622,078 I13M probably benign Het
Kif21a A G 15: 90,980,919 F517L possibly damaging Het
Lrrc4 T C 6: 28,829,763 T618A probably benign Het
Mdn1 A G 4: 32,691,229 T952A probably benign Het
Mindy3 A T 2: 12,397,517 I208K probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 A G 14: 103,212,623 I1744T probably damaging Het
Nanog A T 6: 122,713,472 R279W probably damaging Het
Ncoa2 T A 1: 13,174,537 T646S probably damaging Het
Ndufa5 A G 6: 24,518,725 *117R probably null Het
Nudt18 A T 14: 70,579,836 E293D probably benign Het
Olfr381 A G 11: 73,486,600 S75P probably damaging Het
Olfr612 A T 7: 103,538,619 V205E probably damaging Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Pih1d2 T C 9: 50,618,258 probably null Het
Ppp2r3d A G 9: 124,442,696 F17L Het
Ptprk T C 10: 28,466,040 I481T probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Raet1d T C 10: 22,372,257 S225P possibly damaging Het
Rnf24 T C 2: 131,322,215 probably benign Het
Ror1 A G 4: 100,441,490 S687G probably damaging Het
Rsph9 A G 17: 46,135,087 S186P probably damaging Het
Sash1 C T 10: 8,729,391 M1078I probably benign Het
Scd4 C A 19: 44,339,071 D195E probably benign Het
Syn3 A G 10: 86,069,076 C348R probably damaging Het
Uspl1 T C 5: 149,215,017 F1009S probably benign Het
Vmn1r2 T A 4: 3,172,149 F23I probably benign Het
Zfp839 C T 12: 110,868,792 T827I probably benign Het
Other mutations in Cldn20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Cldn20 APN 17 3533100 missense probably benign 0.16
IGL03175:Cldn20 APN 17 3533134 missense probably benign 0.02
R1130:Cldn20 UTSW 17 3532968 missense probably damaging 1.00
R1721:Cldn20 UTSW 17 3532882 missense probably damaging 1.00
R3972:Cldn20 UTSW 17 3532639 missense probably benign 0.26
R4388:Cldn20 UTSW 17 3533210 missense probably benign
R6467:Cldn20 UTSW 17 3532717 missense possibly damaging 0.75
R7384:Cldn20 UTSW 17 3532611 missense probably damaging 1.00
R7578:Cldn20 UTSW 17 3532999 missense probably damaging 0.99
R7727:Cldn20 UTSW 17 3532755 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTGCTGTTGTCCAGGTGC -3'
(R):5'- GTAGTAGCATCGCCGAAATAAACC -3'

Sequencing Primer
(F):5'- TCCAGGTGCAGGGGTTG -3'
(R):5'- AATGTACAGGGCTCCTCCAG -3'
Posted On2019-11-12