Incidental Mutation 'R7662:Rgsl1'
ID591601
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Nameregulator of G-protein signaling like 1
SynonymsRgsl2, 4930415K13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7662 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location153779381-153844142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153825479 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 410 (I410V)
Ref Sequence ENSEMBL: ENSMUSP00000135642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]
Predicted Effect probably benign
Transcript: ENSMUST00000124558
AA Change: I410V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: I410V

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184095
Predicted Effect probably benign
Transcript: ENSMUST00000185164
AA Change: I445V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: I445V

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T C 11: 58,447,443 N41S probably benign Het
4930563M21Rik G A 9: 55,978,715 S48L probably benign Het
5830411N06Rik T C 7: 140,294,812 V401A possibly damaging Het
Abi3bp A G 16: 56,617,323 probably null Het
Adssl1 T A 12: 112,639,738 V456E probably damaging Het
Aimp1 A T 3: 132,674,066 V105E probably benign Het
Ankrd6 G A 4: 32,818,694 R270C probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asb15 T A 6: 24,566,090 D347E probably benign Het
Axin2 T A 11: 108,942,456 L489Q possibly damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
BC003331 T C 1: 150,382,294 S197G probably benign Het
Cdc6 T A 11: 98,910,612 N194K possibly damaging Het
Cdc6 T C 11: 98,917,010 L443P probably benign Het
Celf2 C A 2: 6,553,917 G393C probably damaging Het
Cep290 T A 10: 100,537,803 M1315K probably benign Het
Cntn5 A T 9: 9,661,385 M887K probably benign Het
Col17a1 T C 19: 47,681,501 I71V probably benign Het
Crot T C 5: 8,969,072 M494V probably damaging Het
Ctnna2 A T 6: 77,636,869 V246D probably damaging Het
Cyb5r4 A G 9: 87,027,038 E56G possibly damaging Het
Dennd2a A G 6: 39,493,103 Y552H probably benign Het
Dennd4a A G 9: 64,852,431 I273V probably damaging Het
Dkk2 A G 3: 132,177,868 probably null Het
Dnaja2 A C 8: 85,539,276 D393E probably benign Het
Dscc1 T A 15: 55,076,165 I461F possibly damaging Het
Dspp A T 5: 104,177,870 S700C unknown Het
Ect2 T A 3: 27,131,798 H512L probably damaging Het
Eif1b A G 9: 120,494,211 T46A possibly damaging Het
Fam114a2 A T 11: 57,507,565 D182E probably damaging Het
Fez1 C A 9: 36,870,500 P347H probably damaging Het
Fgd5 G A 6: 92,049,931 probably null Het
Flad1 T A 3: 89,403,451 I430F probably damaging Het
Gal3st2b T C 1: 93,940,892 Y282H probably damaging Het
Gm29106 T A 1: 118,199,407 N276K possibly damaging Het
Gm36176 C A 10: 77,846,852 S16Y unknown Het
Gm5624 T C 14: 44,561,933 R56G possibly damaging Het
Gpatch11 A C 17: 78,839,055 Q43P probably benign Het
Gtpbp2 A G 17: 46,166,435 T409A probably benign Het
Hmcn2 T C 2: 31,382,345 I1279T probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Itih3 T A 14: 30,917,330 N429Y probably benign Het
Lrp5 A G 19: 3,686,353 probably null Het
Lrrc34 T A 3: 30,643,303 Y93F probably benign Het
Malrd1 T A 2: 15,871,454 V1404D unknown Het
Med1 T C 11: 98,155,392 N1526S unknown Het
Myt1l A G 12: 29,826,869 D173G unknown Het
Nckap1l A T 15: 103,462,585 H197L probably damaging Het
Nipa1 T C 7: 55,979,624 E247G probably damaging Het
Nmrk1 A T 19: 18,642,178 R132* probably null Het
Nrap G T 19: 56,320,283 A1700E probably benign Het
Olfr1340 T A 4: 118,726,307 F20Y probably damaging Het
Olfr951 A T 9: 39,394,093 M98L probably benign Het
Padi6 T C 4: 140,728,995 T563A probably benign Het
Pcdhb19 G A 18: 37,498,735 E528K probably damaging Het
Pcnt T C 10: 76,387,522 D1942G probably benign Het
Pcnx2 C T 8: 125,818,771 W1167* probably null Het
Pkp3 C T 7: 141,078,379 T19I probably benign Het
Plekhg5 T C 4: 152,104,298 L199P probably damaging Het
Rasal1 A G 5: 120,662,184 T171A probably benign Het
Sftpa1 C A 14: 41,134,212 N171K probably damaging Het
Slc5a9 A T 4: 111,877,540 *686R probably null Het
Smap1 A T 1: 23,877,774 N91K probably damaging Het
Tenm3 A G 8: 48,335,727 S695P probably benign Het
Thoc3 A T 13: 54,463,804 H223Q probably damaging Het
Tmco4 T C 4: 139,010,561 F156L probably benign Het
Tmem30a C T 9: 79,775,231 V188I probably benign Het
Trim27 T A 13: 21,192,158 C359S probably benign Het
Trrap A G 5: 144,832,511 T2609A probably benign Het
Ttn A G 2: 76,862,400 V446A Het
Vat1l T A 8: 114,282,344 Y273N probably damaging Het
Vmn1r129 T A 7: 21,360,627 H222L possibly damaging Het
Vmn2r19 A G 6: 123,331,562 T533A probably benign Het
Vmn2r77 T A 7: 86,811,284 L606* probably null Het
Vmn2r93 G T 17: 18,305,369 V430L probably benign Het
Vps50 T A 6: 3,562,304 N466K probably damaging Het
Zfp507 A T 7: 35,787,804 Y746* probably null Het
Zfp521 A C 18: 13,844,116 L1080R probably damaging Het
Zfp74 A G 7: 29,953,853 probably null Het
Zfp831 G A 2: 174,646,141 A870T possibly damaging Het
Zfp936 A T 7: 43,189,912 K268* probably null Het
Zhx2 C A 15: 57,822,176 R314S probably damaging Het
Zkscan16 A T 4: 58,957,679 K654* probably null Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153826141 missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153793767 missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153804009 splice site probably null
IGL02409:Rgsl1 APN 1 153826243 missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153799938 missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153825490 missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153807708 missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153826202 missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153799947 missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153825941 missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153825841 missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153793755 missense probably null 0.82
IGL03050:Rgsl1 UTSW 1 153825676 missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153825970 missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153793764 missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153826181 missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153844107 missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153802328 missense probably damaging 1.00
R0839:Rgsl1 UTSW 1 153802234 critical splice donor site probably null
R1240:Rgsl1 UTSW 1 153785191 missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153807761 start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153825926 missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153799797 missense probably damaging 1.00
R2008:Rgsl1 UTSW 1 153825905 missense possibly damaging 0.53
R2114:Rgsl1 UTSW 1 153817549 missense probably benign
R2116:Rgsl1 UTSW 1 153817549 missense probably benign
R2176:Rgsl1 UTSW 1 153825268 splice site probably benign
R2229:Rgsl1 UTSW 1 153822358 missense possibly damaging 0.72
R2895:Rgsl1 UTSW 1 153827548 missense probably damaging 1.00
R3923:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153817584 missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153802341 missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153827536 missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153817582 missense probably benign 0.01
R4925:Rgsl1 UTSW 1 153812277 missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153793768 missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153821522 nonsense probably null
R5304:Rgsl1 UTSW 1 153827492 missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153802292 missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153793774 missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153825893 missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153799872 missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153812238 missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153804021 missense possibly damaging 0.72
R6184:Rgsl1 UTSW 1 153827448 missense probably benign 0.08
R6273:Rgsl1 UTSW 1 153827465 missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153827545 missense possibly damaging 0.86
R6419:Rgsl1 UTSW 1 153822371 missense probably damaging 0.98
R6568:Rgsl1 UTSW 1 153821546 missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153825766 missense possibly damaging 0.70
R6745:Rgsl1 UTSW 1 153822317 missense probably benign 0.18
R6892:Rgsl1 UTSW 1 153821499 nonsense probably null
R6974:Rgsl1 UTSW 1 153799822 missense probably damaging 1.00
R7172:Rgsl1 UTSW 1 153826220 missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153785199 missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153807876 critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153793845 missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153844101 critical splice donor site probably null
R7703:Rgsl1 UTSW 1 153793864 missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153826037 missense possibly damaging 0.53
X0020:Rgsl1 UTSW 1 153825385 missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153804033 missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153817610 missense possibly damaging 0.70
Z1177:Rgsl1 UTSW 1 153825988 missense not run
Predicted Primers PCR Primer
(F):5'- GACATGGCCTACCTTGCAGATC -3'
(R):5'- TTATTAACCATGCTGCCCCG -3'

Sequencing Primer
(F):5'- TTGGGAATCCAGGGGTTCACC -3'
(R):5'- CCGCTGGTTGTCAAGAAGTCTC -3'
Posted On2019-11-12