Incidental Mutation 'R7662:Pkp3'
ID591637
Institutional Source Beutler Lab
Gene Symbol Pkp3
Ensembl Gene ENSMUSG00000054065
Gene Nameplakophilin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7662 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141078218-141090510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141078379 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 19 (T19I)
Ref Sequence ENSEMBL: ENSMUSP00000101654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066873] [ENSMUST00000106039] [ENSMUST00000159375] [ENSMUST00000160869] [ENSMUST00000163041]
Predicted Effect probably benign
Transcript: ENSMUST00000066873
SMART Domains Protein: ENSMUSP00000069961
Gene: ENSMUSG00000054065

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
ARM 350 390 8.11e-5 SMART
ARM 392 432 3.24e-4 SMART
ARM 489 536 3.85e0 SMART
internal_repeat_1 605 702 2.91e-9 PROSPERO
low complexity region 717 731 N/A INTRINSIC
low complexity region 757 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106039
AA Change: T19I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101654
Gene: ENSMUSG00000054065
AA Change: T19I

DomainStartEndE-ValueType
low complexity region 65 79 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 204 219 N/A INTRINSIC
low complexity region 244 253 N/A INTRINSIC
ARM 375 415 8.11e-5 SMART
ARM 417 457 3.24e-4 SMART
ARM 514 561 3.85e0 SMART
internal_repeat_1 630 727 4.99e-9 PROSPERO
low complexity region 742 756 N/A INTRINSIC
low complexity region 782 799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159375
Predicted Effect probably benign
Transcript: ENSMUST00000160869
SMART Domains Protein: ENSMUSP00000124013
Gene: ENSMUSG00000054065

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163041
SMART Domains Protein: ENSMUSP00000124434
Gene: ENSMUSG00000054065

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
low complexity region 141 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may act in cellular desmosome-dependent adhesion and signaling pathways. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit retarded hair growth, epidermal thickening and abnormal hair follicles that lead to secondary alopecia and acute dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T C 11: 58,447,443 N41S probably benign Het
4930563M21Rik G A 9: 55,978,715 S48L probably benign Het
5830411N06Rik T C 7: 140,294,812 V401A possibly damaging Het
Abi3bp A G 16: 56,617,323 probably null Het
Adssl1 T A 12: 112,639,738 V456E probably damaging Het
Aimp1 A T 3: 132,674,066 V105E probably benign Het
Ankrd6 G A 4: 32,818,694 R270C probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asb15 T A 6: 24,566,090 D347E probably benign Het
Axin2 T A 11: 108,942,456 L489Q possibly damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
BC003331 T C 1: 150,382,294 S197G probably benign Het
Cdc6 T A 11: 98,910,612 N194K possibly damaging Het
Cdc6 T C 11: 98,917,010 L443P probably benign Het
Celf2 C A 2: 6,553,917 G393C probably damaging Het
Cep290 T A 10: 100,537,803 M1315K probably benign Het
Cntn5 A T 9: 9,661,385 M887K probably benign Het
Col17a1 T C 19: 47,681,501 I71V probably benign Het
Crot T C 5: 8,969,072 M494V probably damaging Het
Ctnna2 A T 6: 77,636,869 V246D probably damaging Het
Cyb5r4 A G 9: 87,027,038 E56G possibly damaging Het
Dennd2a A G 6: 39,493,103 Y552H probably benign Het
Dennd4a A G 9: 64,852,431 I273V probably damaging Het
Dkk2 A G 3: 132,177,868 probably null Het
Dnaja2 A C 8: 85,539,276 D393E probably benign Het
Dscc1 T A 15: 55,076,165 I461F possibly damaging Het
Dspp A T 5: 104,177,870 S700C unknown Het
Ect2 T A 3: 27,131,798 H512L probably damaging Het
Eif1b A G 9: 120,494,211 T46A possibly damaging Het
Fam114a2 A T 11: 57,507,565 D182E probably damaging Het
Fez1 C A 9: 36,870,500 P347H probably damaging Het
Fgd5 G A 6: 92,049,931 probably null Het
Flad1 T A 3: 89,403,451 I430F probably damaging Het
Gal3st2b T C 1: 93,940,892 Y282H probably damaging Het
Gm29106 T A 1: 118,199,407 N276K possibly damaging Het
Gm36176 C A 10: 77,846,852 S16Y unknown Het
Gm5624 T C 14: 44,561,933 R56G possibly damaging Het
Gpatch11 A C 17: 78,839,055 Q43P probably benign Het
Gtpbp2 A G 17: 46,166,435 T409A probably benign Het
Hmcn2 T C 2: 31,382,345 I1279T probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Itih3 T A 14: 30,917,330 N429Y probably benign Het
Lrp5 A G 19: 3,686,353 probably null Het
Lrrc34 T A 3: 30,643,303 Y93F probably benign Het
Malrd1 T A 2: 15,871,454 V1404D unknown Het
Med1 T C 11: 98,155,392 N1526S unknown Het
Myt1l A G 12: 29,826,869 D173G unknown Het
Nckap1l A T 15: 103,462,585 H197L probably damaging Het
Nipa1 T C 7: 55,979,624 E247G probably damaging Het
Nmrk1 A T 19: 18,642,178 R132* probably null Het
Nrap G T 19: 56,320,283 A1700E probably benign Het
Olfr1340 T A 4: 118,726,307 F20Y probably damaging Het
Olfr951 A T 9: 39,394,093 M98L probably benign Het
Padi6 T C 4: 140,728,995 T563A probably benign Het
Pcdhb19 G A 18: 37,498,735 E528K probably damaging Het
Pcnt T C 10: 76,387,522 D1942G probably benign Het
Pcnx2 C T 8: 125,818,771 W1167* probably null Het
Plekhg5 T C 4: 152,104,298 L199P probably damaging Het
Rasal1 A G 5: 120,662,184 T171A probably benign Het
Rgsl1 T C 1: 153,825,479 I410V probably benign Het
Sftpa1 C A 14: 41,134,212 N171K probably damaging Het
Slc5a9 A T 4: 111,877,540 *686R probably null Het
Smap1 A T 1: 23,877,774 N91K probably damaging Het
Tenm3 A G 8: 48,335,727 S695P probably benign Het
Thoc3 A T 13: 54,463,804 H223Q probably damaging Het
Tmco4 T C 4: 139,010,561 F156L probably benign Het
Tmem30a C T 9: 79,775,231 V188I probably benign Het
Trim27 T A 13: 21,192,158 C359S probably benign Het
Trrap A G 5: 144,832,511 T2609A probably benign Het
Ttn A G 2: 76,862,400 V446A Het
Vat1l T A 8: 114,282,344 Y273N probably damaging Het
Vmn1r129 T A 7: 21,360,627 H222L possibly damaging Het
Vmn2r19 A G 6: 123,331,562 T533A probably benign Het
Vmn2r77 T A 7: 86,811,284 L606* probably null Het
Vmn2r93 G T 17: 18,305,369 V430L probably benign Het
Vps50 T A 6: 3,562,304 N466K probably damaging Het
Zfp507 A T 7: 35,787,804 Y746* probably null Het
Zfp521 A C 18: 13,844,116 L1080R probably damaging Het
Zfp74 A G 7: 29,953,853 probably null Het
Zfp831 G A 2: 174,646,141 A870T possibly damaging Het
Zfp936 A T 7: 43,189,912 K268* probably null Het
Zhx2 C A 15: 57,822,176 R314S probably damaging Het
Zkscan16 A T 4: 58,957,679 K654* probably null Het
Other mutations in Pkp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pkp3 APN 7 141084182 nonsense probably null
IGL01367:Pkp3 APN 7 141084076 missense probably damaging 1.00
IGL01793:Pkp3 APN 7 141088904 missense probably benign 0.01
IGL02140:Pkp3 APN 7 141089336 missense probably damaging 1.00
IGL02231:Pkp3 APN 7 141084238 missense probably damaging 1.00
IGL02708:Pkp3 APN 7 141089768 unclassified probably benign
IGL02755:Pkp3 APN 7 141088405 splice site probably null
IGL03017:Pkp3 APN 7 141083370 missense probably benign 0.12
IGL03351:Pkp3 APN 7 141082693 missense probably benign
PIT4514001:Pkp3 UTSW 7 141089710 missense probably damaging 0.99
R0145:Pkp3 UTSW 7 141089763 critical splice donor site probably null
R0153:Pkp3 UTSW 7 141083343 missense probably damaging 1.00
R0184:Pkp3 UTSW 7 141088367 missense probably benign 0.41
R1014:Pkp3 UTSW 7 141082826 missense probably benign 0.03
R1664:Pkp3 UTSW 7 141087647 missense probably damaging 1.00
R1844:Pkp3 UTSW 7 141088502 missense probably damaging 1.00
R1891:Pkp3 UTSW 7 141084056 splice site probably null
R2100:Pkp3 UTSW 7 141083292 missense probably damaging 1.00
R3772:Pkp3 UTSW 7 141082346 start codon destroyed probably null
R4003:Pkp3 UTSW 7 141088737 critical splice acceptor site probably null
R4089:Pkp3 UTSW 7 141084143 missense probably damaging 1.00
R4670:Pkp3 UTSW 7 141082699 missense probably benign 0.00
R5266:Pkp3 UTSW 7 141083277 missense probably damaging 1.00
R5619:Pkp3 UTSW 7 141088506 missense probably damaging 1.00
R6113:Pkp3 UTSW 7 141082656 missense probably damaging 0.97
R6820:Pkp3 UTSW 7 141079844 critical splice donor site probably null
R7650:Pkp3 UTSW 7 141082370 missense probably benign 0.00
R8087:Pkp3 UTSW 7 141087638 missense possibly damaging 0.56
R8335:Pkp3 UTSW 7 141087756 missense probably damaging 1.00
X0028:Pkp3 UTSW 7 141089948 splice site probably null
Z1177:Pkp3 UTSW 7 141082735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACGTCTCCCAGGGAAG -3'
(R):5'- TCAGAGAATGACAGCATCCAG -3'

Sequencing Primer
(F):5'- GCAACCGGTCTGATGAGATG -3'
(R):5'- TGACAGCATCCAGGACAGGATC -3'
Posted On2019-11-12