Incidental Mutation 'R7662:Vat1l'
ID591640
Institutional Source Beutler Lab
Gene Symbol Vat1l
Ensembl Gene ENSMUSG00000046844
Gene Namevesicle amine transport protein 1 like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7662 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location114205612-114374071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114282344 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 273 (Y273N)
Ref Sequence ENSEMBL: ENSMUSP00000053431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049509]
Predicted Effect probably damaging
Transcript: ENSMUST00000049509
AA Change: Y273N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053431
Gene: ENSMUSG00000046844
AA Change: Y273N

DomainStartEndE-ValueType
Pfam:ADH_N 66 142 3.9e-14 PFAM
Pfam:ADH_zinc_N 190 302 1.4e-11 PFAM
Pfam:ADH_zinc_N_2 221 376 1.1e-14 PFAM
low complexity region 389 408 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T C 11: 58,447,443 N41S probably benign Het
4930563M21Rik G A 9: 55,978,715 S48L probably benign Het
5830411N06Rik T C 7: 140,294,812 V401A possibly damaging Het
Abi3bp A G 16: 56,617,323 probably null Het
Adssl1 T A 12: 112,639,738 V456E probably damaging Het
Aimp1 A T 3: 132,674,066 V105E probably benign Het
Ankrd6 G A 4: 32,818,694 R270C probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asb15 T A 6: 24,566,090 D347E probably benign Het
Axin2 T A 11: 108,942,456 L489Q possibly damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
BC003331 T C 1: 150,382,294 S197G probably benign Het
Cdc6 T A 11: 98,910,612 N194K possibly damaging Het
Cdc6 T C 11: 98,917,010 L443P probably benign Het
Celf2 C A 2: 6,553,917 G393C probably damaging Het
Cep290 T A 10: 100,537,803 M1315K probably benign Het
Cntn5 A T 9: 9,661,385 M887K probably benign Het
Col17a1 T C 19: 47,681,501 I71V probably benign Het
Crot T C 5: 8,969,072 M494V probably damaging Het
Ctnna2 A T 6: 77,636,869 V246D probably damaging Het
Cyb5r4 A G 9: 87,027,038 E56G possibly damaging Het
Dennd2a A G 6: 39,493,103 Y552H probably benign Het
Dennd4a A G 9: 64,852,431 I273V probably damaging Het
Dkk2 A G 3: 132,177,868 probably null Het
Dnaja2 A C 8: 85,539,276 D393E probably benign Het
Dscc1 T A 15: 55,076,165 I461F possibly damaging Het
Dspp A T 5: 104,177,870 S700C unknown Het
Ect2 T A 3: 27,131,798 H512L probably damaging Het
Eif1b A G 9: 120,494,211 T46A possibly damaging Het
Fam114a2 A T 11: 57,507,565 D182E probably damaging Het
Fez1 C A 9: 36,870,500 P347H probably damaging Het
Fgd5 G A 6: 92,049,931 probably null Het
Flad1 T A 3: 89,403,451 I430F probably damaging Het
Gal3st2b T C 1: 93,940,892 Y282H probably damaging Het
Gm29106 T A 1: 118,199,407 N276K possibly damaging Het
Gm36176 C A 10: 77,846,852 S16Y unknown Het
Gm5624 T C 14: 44,561,933 R56G possibly damaging Het
Gpatch11 A C 17: 78,839,055 Q43P probably benign Het
Gtpbp2 A G 17: 46,166,435 T409A probably benign Het
Hmcn2 T C 2: 31,382,345 I1279T probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Itih3 T A 14: 30,917,330 N429Y probably benign Het
Lrp5 A G 19: 3,686,353 probably null Het
Lrrc34 T A 3: 30,643,303 Y93F probably benign Het
Malrd1 T A 2: 15,871,454 V1404D unknown Het
Med1 T C 11: 98,155,392 N1526S unknown Het
Myt1l A G 12: 29,826,869 D173G unknown Het
Nckap1l A T 15: 103,462,585 H197L probably damaging Het
Nipa1 T C 7: 55,979,624 E247G probably damaging Het
Nmrk1 A T 19: 18,642,178 R132* probably null Het
Nrap G T 19: 56,320,283 A1700E probably benign Het
Olfr1340 T A 4: 118,726,307 F20Y probably damaging Het
Olfr951 A T 9: 39,394,093 M98L probably benign Het
Padi6 T C 4: 140,728,995 T563A probably benign Het
Pcdhb19 G A 18: 37,498,735 E528K probably damaging Het
Pcnt T C 10: 76,387,522 D1942G probably benign Het
Pcnx2 C T 8: 125,818,771 W1167* probably null Het
Pkp3 C T 7: 141,078,379 T19I probably benign Het
Plekhg5 T C 4: 152,104,298 L199P probably damaging Het
Rasal1 A G 5: 120,662,184 T171A probably benign Het
Rgsl1 T C 1: 153,825,479 I410V probably benign Het
Sftpa1 C A 14: 41,134,212 N171K probably damaging Het
Slc5a9 A T 4: 111,877,540 *686R probably null Het
Smap1 A T 1: 23,877,774 N91K probably damaging Het
Tenm3 A G 8: 48,335,727 S695P probably benign Het
Thoc3 A T 13: 54,463,804 H223Q probably damaging Het
Tmco4 T C 4: 139,010,561 F156L probably benign Het
Tmem30a C T 9: 79,775,231 V188I probably benign Het
Trim27 T A 13: 21,192,158 C359S probably benign Het
Trrap A G 5: 144,832,511 T2609A probably benign Het
Ttn A G 2: 76,862,400 V446A Het
Vmn1r129 T A 7: 21,360,627 H222L possibly damaging Het
Vmn2r19 A G 6: 123,331,562 T533A probably benign Het
Vmn2r77 T A 7: 86,811,284 L606* probably null Het
Vmn2r93 G T 17: 18,305,369 V430L probably benign Het
Vps50 T A 6: 3,562,304 N466K probably damaging Het
Zfp507 A T 7: 35,787,804 Y746* probably null Het
Zfp521 A C 18: 13,844,116 L1080R probably damaging Het
Zfp74 A G 7: 29,953,853 probably null Het
Zfp831 G A 2: 174,646,141 A870T possibly damaging Het
Zfp936 A T 7: 43,189,912 K268* probably null Het
Zhx2 C A 15: 57,822,176 R314S probably damaging Het
Zkscan16 A T 4: 58,957,679 K654* probably null Het
Other mutations in Vat1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Vat1l APN 8 114369889 missense possibly damaging 0.89
IGL03379:Vat1l APN 8 114282266 missense probably damaging 0.98
R0504:Vat1l UTSW 8 114236579 splice site probably benign
R1222:Vat1l UTSW 8 114282361 splice site probably benign
R1418:Vat1l UTSW 8 114282361 splice site probably benign
R1859:Vat1l UTSW 8 114271301 missense probably damaging 1.00
R3777:Vat1l UTSW 8 114236800 critical splice donor site probably null
R3778:Vat1l UTSW 8 114236800 critical splice donor site probably null
R4154:Vat1l UTSW 8 114205803 missense possibly damaging 0.94
R4158:Vat1l UTSW 8 114371729 missense probably benign 0.32
R4160:Vat1l UTSW 8 114371729 missense probably benign 0.32
R4285:Vat1l UTSW 8 114205783 missense probably damaging 0.97
R4507:Vat1l UTSW 8 114205816 missense probably benign 0.02
R5316:Vat1l UTSW 8 114284348 missense probably damaging 1.00
R6306:Vat1l UTSW 8 114371651 missense probably damaging 1.00
R7031:Vat1l UTSW 8 114271432 missense possibly damaging 0.60
R7162:Vat1l UTSW 8 114236778 missense probably damaging 0.99
R7378:Vat1l UTSW 8 114289392 missense possibly damaging 0.93
R7472:Vat1l UTSW 8 114236799 critical splice donor site probably null
RF032:Vat1l UTSW 8 114289329 missense probably damaging 1.00
RF035:Vat1l UTSW 8 114289329 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236622 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236623 missense probably damaging 1.00
Z1188:Vat1l UTSW 8 114205723 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCCTGGACTGCTCACTCT -3'
(R):5'- GATAGGGCAATAGACAAACAAGTTT -3'

Sequencing Primer
(F):5'- CACTCTTTGTGTTCTGGAAATCAG -3'
(R):5'- GGGCAATAGACAAACAAGTTTATAAC -3'
Posted On2019-11-12