Incidental Mutation 'R7662:Pcnx2'
ID591641
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7662 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 125818771 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 1167 (W1167*)
Ref Sequence ENSEMBL: ENSMUSP00000042294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239]
Predicted Effect probably null
Transcript: ENSMUST00000047239
AA Change: W1167*
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: W1167*

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T C 11: 58,447,443 N41S probably benign Het
4930563M21Rik G A 9: 55,978,715 S48L probably benign Het
5830411N06Rik T C 7: 140,294,812 V401A possibly damaging Het
Abi3bp A G 16: 56,617,323 probably null Het
Adssl1 T A 12: 112,639,738 V456E probably damaging Het
Aimp1 A T 3: 132,674,066 V105E probably benign Het
Ankrd6 G A 4: 32,818,694 R270C probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asb15 T A 6: 24,566,090 D347E probably benign Het
Axin2 T A 11: 108,942,456 L489Q possibly damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
BC003331 T C 1: 150,382,294 S197G probably benign Het
Cdc6 T A 11: 98,910,612 N194K possibly damaging Het
Cdc6 T C 11: 98,917,010 L443P probably benign Het
Celf2 C A 2: 6,553,917 G393C probably damaging Het
Cep290 T A 10: 100,537,803 M1315K probably benign Het
Cntn5 A T 9: 9,661,385 M887K probably benign Het
Col17a1 T C 19: 47,681,501 I71V probably benign Het
Crot T C 5: 8,969,072 M494V probably damaging Het
Ctnna2 A T 6: 77,636,869 V246D probably damaging Het
Cyb5r4 A G 9: 87,027,038 E56G possibly damaging Het
Dennd2a A G 6: 39,493,103 Y552H probably benign Het
Dennd4a A G 9: 64,852,431 I273V probably damaging Het
Dkk2 A G 3: 132,177,868 probably null Het
Dnaja2 A C 8: 85,539,276 D393E probably benign Het
Dscc1 T A 15: 55,076,165 I461F possibly damaging Het
Dspp A T 5: 104,177,870 S700C unknown Het
Ect2 T A 3: 27,131,798 H512L probably damaging Het
Eif1b A G 9: 120,494,211 T46A possibly damaging Het
Fam114a2 A T 11: 57,507,565 D182E probably damaging Het
Fez1 C A 9: 36,870,500 P347H probably damaging Het
Fgd5 G A 6: 92,049,931 probably null Het
Flad1 T A 3: 89,403,451 I430F probably damaging Het
Gal3st2b T C 1: 93,940,892 Y282H probably damaging Het
Gm29106 T A 1: 118,199,407 N276K possibly damaging Het
Gm36176 C A 10: 77,846,852 S16Y unknown Het
Gm5624 T C 14: 44,561,933 R56G possibly damaging Het
Gpatch11 A C 17: 78,839,055 Q43P probably benign Het
Gtpbp2 A G 17: 46,166,435 T409A probably benign Het
Hmcn2 T C 2: 31,382,345 I1279T probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Itih3 T A 14: 30,917,330 N429Y probably benign Het
Lrp5 A G 19: 3,686,353 probably null Het
Lrrc34 T A 3: 30,643,303 Y93F probably benign Het
Malrd1 T A 2: 15,871,454 V1404D unknown Het
Med1 T C 11: 98,155,392 N1526S unknown Het
Myt1l A G 12: 29,826,869 D173G unknown Het
Nckap1l A T 15: 103,462,585 H197L probably damaging Het
Nipa1 T C 7: 55,979,624 E247G probably damaging Het
Nmrk1 A T 19: 18,642,178 R132* probably null Het
Nrap G T 19: 56,320,283 A1700E probably benign Het
Olfr1340 T A 4: 118,726,307 F20Y probably damaging Het
Olfr951 A T 9: 39,394,093 M98L probably benign Het
Padi6 T C 4: 140,728,995 T563A probably benign Het
Pcdhb19 G A 18: 37,498,735 E528K probably damaging Het
Pcnt T C 10: 76,387,522 D1942G probably benign Het
Pkp3 C T 7: 141,078,379 T19I probably benign Het
Plekhg5 T C 4: 152,104,298 L199P probably damaging Het
Rasal1 A G 5: 120,662,184 T171A probably benign Het
Rgsl1 T C 1: 153,825,479 I410V probably benign Het
Sftpa1 C A 14: 41,134,212 N171K probably damaging Het
Slc5a9 A T 4: 111,877,540 *686R probably null Het
Smap1 A T 1: 23,877,774 N91K probably damaging Het
Tenm3 A G 8: 48,335,727 S695P probably benign Het
Thoc3 A T 13: 54,463,804 H223Q probably damaging Het
Tmco4 T C 4: 139,010,561 F156L probably benign Het
Tmem30a C T 9: 79,775,231 V188I probably benign Het
Trim27 T A 13: 21,192,158 C359S probably benign Het
Trrap A G 5: 144,832,511 T2609A probably benign Het
Ttn A G 2: 76,862,400 V446A Het
Vat1l T A 8: 114,282,344 Y273N probably damaging Het
Vmn1r129 T A 7: 21,360,627 H222L possibly damaging Het
Vmn2r19 A G 6: 123,331,562 T533A probably benign Het
Vmn2r77 T A 7: 86,811,284 L606* probably null Het
Vmn2r93 G T 17: 18,305,369 V430L probably benign Het
Vps50 T A 6: 3,562,304 N466K probably damaging Het
Zfp507 A T 7: 35,787,804 Y746* probably null Het
Zfp521 A C 18: 13,844,116 L1080R probably damaging Het
Zfp74 A G 7: 29,953,853 probably null Het
Zfp831 G A 2: 174,646,141 A870T possibly damaging Het
Zfp936 A T 7: 43,189,912 K268* probably null Het
Zhx2 C A 15: 57,822,176 R314S probably damaging Het
Zkscan16 A T 4: 58,957,679 K654* probably null Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
gallen UTSW 8 125891120 missense probably damaging 1.00
hotzone UTSW 8 125891141 missense probably benign 0.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 intron probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 intron probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7034:Pcnx2 UTSW 8 125785302 missense probably damaging 1.00
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7124:Pcnx2 UTSW 8 125753617 missense probably damaging 0.99
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
R7271:Pcnx2 UTSW 8 125886951 missense probably benign
R7326:Pcnx2 UTSW 8 125887083 missense probably damaging 1.00
R7373:Pcnx2 UTSW 8 125808027 missense probably damaging 1.00
R7397:Pcnx2 UTSW 8 125890885 intron probably null
R7693:Pcnx2 UTSW 8 125887125 missense probably benign 0.09
R7726:Pcnx2 UTSW 8 125850330 missense probably benign 0.00
R7745:Pcnx2 UTSW 8 125851107 missense probably benign 0.04
R7792:Pcnx2 UTSW 8 125892018 missense possibly damaging 0.63
R7797:Pcnx2 UTSW 8 125785348 missense possibly damaging 0.70
RF018:Pcnx2 UTSW 8 125877519 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125761654 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125838014 missense probably benign 0.30
Z1177:Pcnx2 UTSW 8 125887960 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGAAATCCCAATGGGTTCTG -3'
(R):5'- TTGAAAACACGGGTGCTGAC -3'

Sequencing Primer
(F):5'- CCCAATGGGTTCTGAAAACACTGTG -3'
(R):5'- TCTGTGGACTGGGCAGACTC -3'
Posted On2019-11-12