Incidental Mutation 'R7662:Cep290'
ID591654
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R7662 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100537803 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1315 (M1315K)
Ref Sequence ENSEMBL: ENSMUSP00000130899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219408] [ENSMUST00000219765] [ENSMUST00000220346]
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: M1315K

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: M1315K

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219408
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: M1308K

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: M1315K

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T C 11: 58,447,443 N41S probably benign Het
4930563M21Rik G A 9: 55,978,715 S48L probably benign Het
5830411N06Rik T C 7: 140,294,812 V401A possibly damaging Het
Abi3bp A G 16: 56,617,323 probably null Het
Adssl1 T A 12: 112,639,738 V456E probably damaging Het
Aimp1 A T 3: 132,674,066 V105E probably benign Het
Ankrd6 G A 4: 32,818,694 R270C probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asb15 T A 6: 24,566,090 D347E probably benign Het
Axin2 T A 11: 108,942,456 L489Q possibly damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
BC003331 T C 1: 150,382,294 S197G probably benign Het
Cdc6 T A 11: 98,910,612 N194K possibly damaging Het
Cdc6 T C 11: 98,917,010 L443P probably benign Het
Celf2 C A 2: 6,553,917 G393C probably damaging Het
Cntn5 A T 9: 9,661,385 M887K probably benign Het
Col17a1 T C 19: 47,681,501 I71V probably benign Het
Crot T C 5: 8,969,072 M494V probably damaging Het
Ctnna2 A T 6: 77,636,869 V246D probably damaging Het
Cyb5r4 A G 9: 87,027,038 E56G possibly damaging Het
Dennd2a A G 6: 39,493,103 Y552H probably benign Het
Dennd4a A G 9: 64,852,431 I273V probably damaging Het
Dkk2 A G 3: 132,177,868 probably null Het
Dnaja2 A C 8: 85,539,276 D393E probably benign Het
Dscc1 T A 15: 55,076,165 I461F possibly damaging Het
Dspp A T 5: 104,177,870 S700C unknown Het
Ect2 T A 3: 27,131,798 H512L probably damaging Het
Eif1b A G 9: 120,494,211 T46A possibly damaging Het
Fam114a2 A T 11: 57,507,565 D182E probably damaging Het
Fez1 C A 9: 36,870,500 P347H probably damaging Het
Fgd5 G A 6: 92,049,931 probably null Het
Flad1 T A 3: 89,403,451 I430F probably damaging Het
Gal3st2b T C 1: 93,940,892 Y282H probably damaging Het
Gm29106 T A 1: 118,199,407 N276K possibly damaging Het
Gm36176 C A 10: 77,846,852 S16Y unknown Het
Gm5624 T C 14: 44,561,933 R56G possibly damaging Het
Gpatch11 A C 17: 78,839,055 Q43P probably benign Het
Gtpbp2 A G 17: 46,166,435 T409A probably benign Het
Hmcn2 T C 2: 31,382,345 I1279T probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Itih3 T A 14: 30,917,330 N429Y probably benign Het
Lrp5 A G 19: 3,686,353 probably null Het
Lrrc34 T A 3: 30,643,303 Y93F probably benign Het
Malrd1 T A 2: 15,871,454 V1404D unknown Het
Med1 T C 11: 98,155,392 N1526S unknown Het
Myt1l A G 12: 29,826,869 D173G unknown Het
Nckap1l A T 15: 103,462,585 H197L probably damaging Het
Nipa1 T C 7: 55,979,624 E247G probably damaging Het
Nmrk1 A T 19: 18,642,178 R132* probably null Het
Nrap G T 19: 56,320,283 A1700E probably benign Het
Olfr1340 T A 4: 118,726,307 F20Y probably damaging Het
Olfr951 A T 9: 39,394,093 M98L probably benign Het
Padi6 T C 4: 140,728,995 T563A probably benign Het
Pcdhb19 G A 18: 37,498,735 E528K probably damaging Het
Pcnt T C 10: 76,387,522 D1942G probably benign Het
Pcnx2 C T 8: 125,818,771 W1167* probably null Het
Pkp3 C T 7: 141,078,379 T19I probably benign Het
Plekhg5 T C 4: 152,104,298 L199P probably damaging Het
Rasal1 A G 5: 120,662,184 T171A probably benign Het
Rgsl1 T C 1: 153,825,479 I410V probably benign Het
Sftpa1 C A 14: 41,134,212 N171K probably damaging Het
Slc5a9 A T 4: 111,877,540 *686R probably null Het
Smap1 A T 1: 23,877,774 N91K probably damaging Het
Tenm3 A G 8: 48,335,727 S695P probably benign Het
Thoc3 A T 13: 54,463,804 H223Q probably damaging Het
Tmco4 T C 4: 139,010,561 F156L probably benign Het
Tmem30a C T 9: 79,775,231 V188I probably benign Het
Trim27 T A 13: 21,192,158 C359S probably benign Het
Trrap A G 5: 144,832,511 T2609A probably benign Het
Ttn A G 2: 76,862,400 V446A Het
Vat1l T A 8: 114,282,344 Y273N probably damaging Het
Vmn1r129 T A 7: 21,360,627 H222L possibly damaging Het
Vmn2r19 A G 6: 123,331,562 T533A probably benign Het
Vmn2r77 T A 7: 86,811,284 L606* probably null Het
Vmn2r93 G T 17: 18,305,369 V430L probably benign Het
Vps50 T A 6: 3,562,304 N466K probably damaging Het
Zfp507 A T 7: 35,787,804 Y746* probably null Het
Zfp521 A C 18: 13,844,116 L1080R probably damaging Het
Zfp74 A G 7: 29,953,853 probably null Het
Zfp831 G A 2: 174,646,141 A870T possibly damaging Het
Zfp936 A T 7: 43,189,912 K268* probably null Het
Zhx2 C A 15: 57,822,176 R314S probably damaging Het
Zkscan16 A T 4: 58,957,679 K654* probably null Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 splice site probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7699:Cep290 UTSW 10 100540369 missense probably benign 0.33
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R8078:Cep290 UTSW 10 100572887 missense probably benign 0.04
R8081:Cep290 UTSW 10 100558176 nonsense probably null
R8094:Cep290 UTSW 10 100544931 missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100559671 missense probably benign 0.08
R8305:Cep290 UTSW 10 100544934 missense probably benign 0.09
R8325:Cep290 UTSW 10 100517808 missense probably benign 0.03
R8372:Cep290 UTSW 10 100549341 missense probably benign 0.00
R8443:Cep290 UTSW 10 100495844 missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100551458 missense probably damaging 1.00
R8778:Cep290 UTSW 10 100514512 nonsense probably null
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CGCTTAGAACAGAAACTGGATG -3'
(R):5'- AGCTACCCAATGAGTATGTTAGATG -3'

Sequencing Primer
(F):5'- CTATGCTCGTTTGGAAGGTAGAAAC -3'
(R):5'- CAGCTACAGACTAAGAGCTA -3'
Posted On2019-11-12