Incidental Mutation 'R7662:Gm5624'
ID591667
Institutional Source Beutler Lab
Gene Symbol Gm5624
Ensembl Gene ENSMUSG00000092165
Gene Namepredicted gene 5624
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7662 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location44556795-44627938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44561933 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 56 (R56G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178184] [ENSMUST00000227882] [ENSMUST00000228629]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165769
AA Change: R56G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126636
Gene: ENSMUSG00000092165
AA Change: R56G

DomainStartEndE-ValueType
Pfam:Takusan 57 137 1.2e-27 PFAM
coiled coil region 152 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178184
AA Change: R13G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136815
Gene: ENSMUSG00000092165
AA Change: R13G

DomainStartEndE-ValueType
Pfam:Takusan 13 93 2.2e-27 PFAM
coiled coil region 109 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227882
AA Change: R12G

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000228629
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T C 11: 58,447,443 N41S probably benign Het
4930563M21Rik G A 9: 55,978,715 S48L probably benign Het
5830411N06Rik T C 7: 140,294,812 V401A possibly damaging Het
Abi3bp A G 16: 56,617,323 probably null Het
Adssl1 T A 12: 112,639,738 V456E probably damaging Het
Aimp1 A T 3: 132,674,066 V105E probably benign Het
Ankrd6 G A 4: 32,818,694 R270C probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asb15 T A 6: 24,566,090 D347E probably benign Het
Axin2 T A 11: 108,942,456 L489Q possibly damaging Het
Baiap2l1 G A 5: 144,357,890 probably benign Het
BC003331 T C 1: 150,382,294 S197G probably benign Het
Cdc6 T A 11: 98,910,612 N194K possibly damaging Het
Cdc6 T C 11: 98,917,010 L443P probably benign Het
Celf2 C A 2: 6,553,917 G393C probably damaging Het
Cep290 T A 10: 100,537,803 M1315K probably benign Het
Cntn5 A T 9: 9,661,385 M887K probably benign Het
Col17a1 T C 19: 47,681,501 I71V probably benign Het
Crot T C 5: 8,969,072 M494V probably damaging Het
Ctnna2 A T 6: 77,636,869 V246D probably damaging Het
Cyb5r4 A G 9: 87,027,038 E56G possibly damaging Het
Dennd2a A G 6: 39,493,103 Y552H probably benign Het
Dennd4a A G 9: 64,852,431 I273V probably damaging Het
Dkk2 A G 3: 132,177,868 probably null Het
Dnaja2 A C 8: 85,539,276 D393E probably benign Het
Dscc1 T A 15: 55,076,165 I461F possibly damaging Het
Dspp A T 5: 104,177,870 S700C unknown Het
Ect2 T A 3: 27,131,798 H512L probably damaging Het
Eif1b A G 9: 120,494,211 T46A possibly damaging Het
Fam114a2 A T 11: 57,507,565 D182E probably damaging Het
Fez1 C A 9: 36,870,500 P347H probably damaging Het
Fgd5 G A 6: 92,049,931 probably null Het
Flad1 T A 3: 89,403,451 I430F probably damaging Het
Gal3st2b T C 1: 93,940,892 Y282H probably damaging Het
Gm29106 T A 1: 118,199,407 N276K possibly damaging Het
Gm36176 C A 10: 77,846,852 S16Y unknown Het
Gpatch11 A C 17: 78,839,055 Q43P probably benign Het
Gtpbp2 A G 17: 46,166,435 T409A probably benign Het
Hmcn2 T C 2: 31,382,345 I1279T probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Itih3 T A 14: 30,917,330 N429Y probably benign Het
Lrp5 A G 19: 3,686,353 probably null Het
Lrrc34 T A 3: 30,643,303 Y93F probably benign Het
Malrd1 T A 2: 15,871,454 V1404D unknown Het
Med1 T C 11: 98,155,392 N1526S unknown Het
Myt1l A G 12: 29,826,869 D173G unknown Het
Nckap1l A T 15: 103,462,585 H197L probably damaging Het
Nipa1 T C 7: 55,979,624 E247G probably damaging Het
Nmrk1 A T 19: 18,642,178 R132* probably null Het
Nrap G T 19: 56,320,283 A1700E probably benign Het
Olfr1340 T A 4: 118,726,307 F20Y probably damaging Het
Olfr951 A T 9: 39,394,093 M98L probably benign Het
Padi6 T C 4: 140,728,995 T563A probably benign Het
Pcdhb19 G A 18: 37,498,735 E528K probably damaging Het
Pcnt T C 10: 76,387,522 D1942G probably benign Het
Pcnx2 C T 8: 125,818,771 W1167* probably null Het
Pkp3 C T 7: 141,078,379 T19I probably benign Het
Plekhg5 T C 4: 152,104,298 L199P probably damaging Het
Rasal1 A G 5: 120,662,184 T171A probably benign Het
Rgsl1 T C 1: 153,825,479 I410V probably benign Het
Sftpa1 C A 14: 41,134,212 N171K probably damaging Het
Slc5a9 A T 4: 111,877,540 *686R probably null Het
Smap1 A T 1: 23,877,774 N91K probably damaging Het
Tenm3 A G 8: 48,335,727 S695P probably benign Het
Thoc3 A T 13: 54,463,804 H223Q probably damaging Het
Tmco4 T C 4: 139,010,561 F156L probably benign Het
Tmem30a C T 9: 79,775,231 V188I probably benign Het
Trim27 T A 13: 21,192,158 C359S probably benign Het
Trrap A G 5: 144,832,511 T2609A probably benign Het
Ttn A G 2: 76,862,400 V446A Het
Vat1l T A 8: 114,282,344 Y273N probably damaging Het
Vmn1r129 T A 7: 21,360,627 H222L possibly damaging Het
Vmn2r19 A G 6: 123,331,562 T533A probably benign Het
Vmn2r77 T A 7: 86,811,284 L606* probably null Het
Vmn2r93 G T 17: 18,305,369 V430L probably benign Het
Vps50 T A 6: 3,562,304 N466K probably damaging Het
Zfp507 A T 7: 35,787,804 Y746* probably null Het
Zfp521 A C 18: 13,844,116 L1080R probably damaging Het
Zfp74 A G 7: 29,953,853 probably null Het
Zfp831 G A 2: 174,646,141 A870T possibly damaging Het
Zfp936 A T 7: 43,189,912 K268* probably null Het
Zhx2 C A 15: 57,822,176 R314S probably damaging Het
Zkscan16 A T 4: 58,957,679 K654* probably null Het
Other mutations in Gm5624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Gm5624 APN 14 44559839 critical splice donor site probably null
IGL02682:Gm5624 APN 14 44560012 missense possibly damaging 0.86
IGL03145:Gm5624 APN 14 44560765 missense possibly damaging 0.50
IGL03212:Gm5624 APN 14 44560710 missense probably benign 0.01
R1800:Gm5624 UTSW 14 44561845 missense probably damaging 1.00
R6136:Gm5624 UTSW 14 44559876 missense probably benign 0.17
R6727:Gm5624 UTSW 14 44561875 missense possibly damaging 0.52
R7512:Gm5624 UTSW 14 44561855 missense
R7950:Gm5624 UTSW 14 44560733 missense
R8411:Gm5624 UTSW 14 44561890 missense
R8413:Gm5624 UTSW 14 44561890 missense
Predicted Primers PCR Primer
(F):5'- CAGTCAACAAGAAACTGGGC -3'
(R):5'- CAGCTTTTGGATTTCAGGGC -3'

Sequencing Primer
(F):5'- CTGGGCATAATTTTACCTGTAGTTC -3'
(R):5'- CCAACAGTGGTGGTTGGGAAG -3'
Posted On2019-11-12