Incidental Mutation 'R7663:1110002E22Rik'
ID591691
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R7663 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138066126 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 359 (T359A)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: T359A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: T359A

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A C 12: 84,606,129 V433G probably damaging Het
Acot5 C A 12: 84,069,581 R39S probably damaging Het
Actl9 T C 17: 33,433,469 S168P probably damaging Het
Adam15 A G 3: 89,345,806 L237P probably damaging Het
Ahctf1 T C 1: 179,790,314 Q289R possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asah1 C T 8: 41,341,627 R385Q probably damaging Het
AW549877 T C 15: 3,988,683 Y170C probably damaging Het
Bicc1 T C 10: 70,946,590 T607A probably benign Het
Ccdc88a T C 11: 29,498,614 probably null Het
Cdhr4 A T 9: 107,998,772 R750* probably null Het
Cep290 T A 10: 100,554,536 probably null Het
Clca3a1 T A 3: 144,737,036 D749V probably benign Het
Clcn1 C T 6: 42,310,063 P685S possibly damaging Het
Clk1 A G 1: 58,421,160 S104P probably damaging Het
Commd10 T C 18: 47,086,256 V172A probably benign Het
Cyp2c69 A T 19: 39,877,509 C213* probably null Het
Dock2 C T 11: 34,721,027 G170R probably damaging Het
Fam186a T G 15: 99,945,069 H1098P probably benign Het
Flt1 T C 5: 147,655,120 T511A probably benign Het
Fmo1 A C 1: 162,836,297 I221S possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Ginm1 A T 10: 7,775,362 S93R possibly damaging Het
Gm10251 A C 14: 6,675,701 probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gys2 C T 6: 142,459,485 R192H probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hectd4 C A 5: 121,324,031 A987E probably benign Het
Herc2 G A 7: 56,136,685 V1593I probably benign Het
Ighv14-3 T C 12: 114,059,934 T88A probably benign Het
Jag2 T C 12: 112,913,666 D695G probably damaging Het
Kazn A T 4: 142,104,898 D663E Het
Krt79 T C 15: 101,931,843 D306G probably damaging Het
Lama1 T A 17: 67,780,880 C1498S Het
Ldb1 T C 19: 46,035,524 Y141C probably damaging Het
Lmnb2 T A 10: 80,904,739 E336V probably damaging Het
Lrp1b T A 2: 42,653,035 probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 T A 14: 103,191,609 Y2377F probably damaging Het
Neb T A 2: 52,230,047 Y721F Het
Ntf3 A G 6: 126,101,815 S243P probably damaging Het
Olfr1195 G C 2: 88,683,352 P127A probably damaging Het
Olfr1480 G T 19: 13,530,445 M301I probably damaging Het
Olfr593 T C 7: 103,212,445 M195T possibly damaging Het
Pdzd2 A G 15: 12,373,203 V2282A probably damaging Het
Piwil1 T C 5: 128,747,433 F517L probably benign Het
Plch2 T A 4: 154,991,162 T738S probably damaging Het
Plekhm3 G A 1: 64,883,208 R603W probably damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Psmb3 G T 11: 97,712,492 R177L probably damaging Het
Ralgapa2 A G 2: 146,418,415 V764A probably benign Het
Rel T C 11: 23,742,713 D440G probably benign Het
Rims2 T A 15: 39,507,026 V952E probably damaging Het
Samd4b G T 7: 28,423,500 C44* probably null Het
Slamf8 C A 1: 172,588,038 V78F possibly damaging Het
Slc35a1 A T 4: 34,675,493 N111K possibly damaging Het
Slc7a5 A T 8: 121,887,535 Y264* probably null Het
Srsf2 T C 11: 116,852,294 S134G unknown Het
Stag1 T A 9: 100,738,138 M98K probably damaging Het
Trib1 T C 15: 59,651,713 S199P probably damaging Het
Txnip T C 3: 96,559,837 S276P possibly damaging Het
Vmn1r194 C T 13: 22,244,741 T176I not run Het
Vmn1r222 A G 13: 23,232,431 L204P possibly damaging Het
Vmn2r63 T A 7: 42,927,042 H449L probably benign Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vmn2r87 T A 10: 130,472,185 H728L probably damaging Het
Zfp69 G A 4: 120,935,126 A151V probably benign Het
Zfp738 A G 13: 67,683,401 probably null Het
Zfp974 T C 7: 27,911,685 E205G possibly damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCCACCAAGTTACTGGG -3'
(R):5'- CGTAACAGCTATTGTCATCATCTTC -3'

Sequencing Primer
(F):5'- TTAGGCTTTGAGAGTGATCCCGAAAC -3'
(R):5'- CATCATCTTCTTCTGTGGTGATG -3'
Posted On2019-11-12