Incidental Mutation 'R7663:Bicc1'
ID591717
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7663 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70946590 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 607 (T607A)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably benign
Transcript: ENSMUST00000014473
AA Change: T607A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: T607A

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131445
AA Change: T525A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: T525A

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143791
AA Change: T607A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: T607A

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,126 T359A probably damaging Het
Abcd4 A C 12: 84,606,129 V433G probably damaging Het
Acot5 C A 12: 84,069,581 R39S probably damaging Het
Actl9 T C 17: 33,433,469 S168P probably damaging Het
Adam15 A G 3: 89,345,806 L237P probably damaging Het
Ahctf1 T C 1: 179,790,314 Q289R possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asah1 C T 8: 41,341,627 R385Q probably damaging Het
AW549877 T C 15: 3,988,683 Y170C probably damaging Het
Ccdc88a T C 11: 29,498,614 probably null Het
Cdhr4 A T 9: 107,998,772 R750* probably null Het
Cep290 T A 10: 100,554,536 probably null Het
Clca3a1 T A 3: 144,737,036 D749V probably benign Het
Clcn1 C T 6: 42,310,063 P685S possibly damaging Het
Clk1 A G 1: 58,421,160 S104P probably damaging Het
Commd10 T C 18: 47,086,256 V172A probably benign Het
Cyp2c69 A T 19: 39,877,509 C213* probably null Het
Dnah14 A T 1: 181,752,155 probably null Het
Dock2 C T 11: 34,721,027 G170R probably damaging Het
Fam186a T G 15: 99,945,069 H1098P probably benign Het
Flt1 T C 5: 147,655,120 T511A probably benign Het
Fmo1 A C 1: 162,836,297 I221S possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Ginm1 A T 10: 7,775,362 S93R possibly damaging Het
Gm10251 A C 14: 6,675,701 probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gys2 C T 6: 142,459,485 R192H probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hectd4 C A 5: 121,324,031 A987E probably benign Het
Herc2 G A 7: 56,136,685 V1593I probably benign Het
Ighv14-3 T C 12: 114,059,934 T88A probably benign Het
Jag2 T C 12: 112,913,666 D695G probably damaging Het
Kazn A T 4: 142,104,898 D663E Het
Krt79 T C 15: 101,931,843 D306G probably damaging Het
Lama1 T A 17: 67,780,880 C1498S Het
Ldb1 T C 19: 46,035,524 Y141C probably damaging Het
Lmnb2 T A 10: 80,904,739 E336V probably damaging Het
Lrp1b T A 2: 42,653,035 probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 T A 14: 103,191,609 Y2377F probably damaging Het
Neb T A 2: 52,230,047 Y721F Het
Ntf3 A G 6: 126,101,815 S243P probably damaging Het
Olfr1195 G C 2: 88,683,352 P127A probably damaging Het
Olfr1480 G T 19: 13,530,445 M301I probably damaging Het
Olfr593 T C 7: 103,212,445 M195T possibly damaging Het
Pdk1 G A 2: 71,875,398 probably null Het
Pdzd2 A G 15: 12,373,203 V2282A probably damaging Het
Piwil1 T C 5: 128,747,433 F517L probably benign Het
Plch2 T A 4: 154,991,162 T738S probably damaging Het
Plekhm3 G A 1: 64,883,208 R603W probably damaging Het
Pltp A T 2: 164,857,006 probably null Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Psmb3 G T 11: 97,712,492 R177L probably damaging Het
Ralgapa2 A G 2: 146,418,415 V764A probably benign Het
Rel T C 11: 23,742,713 D440G probably benign Het
Rims2 T A 15: 39,507,026 V952E probably damaging Het
Samd4b G T 7: 28,423,500 C44* probably null Het
Slamf8 C A 1: 172,588,038 V78F possibly damaging Het
Slc35a1 A T 4: 34,675,493 N111K possibly damaging Het
Slc7a5 A T 8: 121,887,535 Y264* probably null Het
Srsf2 T C 11: 116,852,294 S134G unknown Het
Stag1 T A 9: 100,738,138 M98K probably damaging Het
Trib1 T C 15: 59,651,713 S199P probably damaging Het
Txnip T C 3: 96,559,837 S276P possibly damaging Het
Vmn1r194 C T 13: 22,244,741 T176I not run Het
Vmn1r222 A G 13: 23,232,431 L204P possibly damaging Het
Vmn2r63 T A 7: 42,927,042 H449L probably benign Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vmn2r87 T A 10: 130,472,185 H728L probably damaging Het
Zfp69 G A 4: 120,935,126 A151V probably benign Het
Zfp738 A G 13: 67,683,401 probably null Het
Zfp974 T C 7: 27,911,685 E205G possibly damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAAGCCAGTCTGCAGTCTCC -3'
(R):5'- CCCTCTTGTGAGATTCAGGG -3'

Sequencing Primer
(F):5'- AGTCTGCAGTCTCCGGGAG -3'
(R):5'- TGAGATTCAGGGGGTGGAG -3'
Posted On2019-11-12