Incidental Mutation 'R7663:Vmn1r222'
ID591733
Institutional Source Beutler Lab
Gene Symbol Vmn1r222
Ensembl Gene ENSMUSG00000061022
Gene Namevomeronasal 1 receptor 222
SynonymsV1rh16
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7663 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location23232066-23233119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23232431 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 204 (L204P)
Ref Sequence ENSEMBL: ENSMUSP00000076365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077116
AA Change: L204P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076365
Gene: ENSMUSG00000061022
AA Change: L204P

DomainStartEndE-ValueType
Pfam:V1R 32 297 3.6e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,126 T359A probably damaging Het
Abcd4 A C 12: 84,606,129 V433G probably damaging Het
Acot5 C A 12: 84,069,581 R39S probably damaging Het
Actl9 T C 17: 33,433,469 S168P probably damaging Het
Adam15 A G 3: 89,345,806 L237P probably damaging Het
Ahctf1 T C 1: 179,790,314 Q289R possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asah1 C T 8: 41,341,627 R385Q probably damaging Het
AW549877 T C 15: 3,988,683 Y170C probably damaging Het
Bicc1 T C 10: 70,946,590 T607A probably benign Het
Ccdc88a T C 11: 29,498,614 probably null Het
Cdhr4 A T 9: 107,998,772 R750* probably null Het
Cep290 T A 10: 100,554,536 probably null Het
Clca3a1 T A 3: 144,737,036 D749V probably benign Het
Clcn1 C T 6: 42,310,063 P685S possibly damaging Het
Clk1 A G 1: 58,421,160 S104P probably damaging Het
Commd10 T C 18: 47,086,256 V172A probably benign Het
Cyp2c69 A T 19: 39,877,509 C213* probably null Het
Dnah14 A T 1: 181,752,155 probably null Het
Dock2 C T 11: 34,721,027 G170R probably damaging Het
Fam186a T G 15: 99,945,069 H1098P probably benign Het
Flt1 T C 5: 147,655,120 T511A probably benign Het
Fmo1 A C 1: 162,836,297 I221S possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Ginm1 A T 10: 7,775,362 S93R possibly damaging Het
Gm10251 A C 14: 6,675,701 probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gys2 C T 6: 142,459,485 R192H probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hectd4 C A 5: 121,324,031 A987E probably benign Het
Herc2 G A 7: 56,136,685 V1593I probably benign Het
Ighv14-3 T C 12: 114,059,934 T88A probably benign Het
Jag2 T C 12: 112,913,666 D695G probably damaging Het
Kazn A T 4: 142,104,898 D663E Het
Krt79 T C 15: 101,931,843 D306G probably damaging Het
Lama1 T A 17: 67,780,880 C1498S Het
Ldb1 T C 19: 46,035,524 Y141C probably damaging Het
Lmnb2 T A 10: 80,904,739 E336V probably damaging Het
Lrp1b T A 2: 42,653,035 probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 T A 14: 103,191,609 Y2377F probably damaging Het
Neb T A 2: 52,230,047 Y721F Het
Ntf3 A G 6: 126,101,815 S243P probably damaging Het
Olfr1195 G C 2: 88,683,352 P127A probably damaging Het
Olfr1480 G T 19: 13,530,445 M301I probably damaging Het
Olfr593 T C 7: 103,212,445 M195T possibly damaging Het
Pdk1 G A 2: 71,875,398 probably null Het
Pdzd2 A G 15: 12,373,203 V2282A probably damaging Het
Piwil1 T C 5: 128,747,433 F517L probably benign Het
Plch2 T A 4: 154,991,162 T738S probably damaging Het
Plekhm3 G A 1: 64,883,208 R603W probably damaging Het
Pltp A T 2: 164,857,006 probably null Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Psmb3 G T 11: 97,712,492 R177L probably damaging Het
Ralgapa2 A G 2: 146,418,415 V764A probably benign Het
Rel T C 11: 23,742,713 D440G probably benign Het
Rims2 T A 15: 39,507,026 V952E probably damaging Het
Samd4b G T 7: 28,423,500 C44* probably null Het
Slamf8 C A 1: 172,588,038 V78F possibly damaging Het
Slc35a1 A T 4: 34,675,493 N111K possibly damaging Het
Slc7a5 A T 8: 121,887,535 Y264* probably null Het
Srsf2 T C 11: 116,852,294 S134G unknown Het
Stag1 T A 9: 100,738,138 M98K probably damaging Het
Trib1 T C 15: 59,651,713 S199P probably damaging Het
Txnip T C 3: 96,559,837 S276P possibly damaging Het
Vmn1r194 C T 13: 22,244,741 T176I not run Het
Vmn2r63 T A 7: 42,927,042 H449L probably benign Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vmn2r87 T A 10: 130,472,185 H728L probably damaging Het
Zfp69 G A 4: 120,935,126 A151V probably benign Het
Zfp738 A G 13: 67,683,401 probably null Het
Zfp974 T C 7: 27,911,685 E205G possibly damaging Het
Other mutations in Vmn1r222
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Vmn1r222 APN 13 23232889 missense probably benign 0.45
IGL01960:Vmn1r222 APN 13 23232145 missense probably benign 0.00
IGL02082:Vmn1r222 APN 13 23232329 missense probably damaging 1.00
IGL02616:Vmn1r222 APN 13 23232141 missense possibly damaging 0.73
IGL03155:Vmn1r222 APN 13 23232693 missense probably damaging 1.00
IGL03333:Vmn1r222 APN 13 23233007 missense probably benign 0.18
IGL03391:Vmn1r222 APN 13 23232462 missense possibly damaging 0.94
R0137:Vmn1r222 UTSW 13 23232804 missense probably damaging 1.00
R1584:Vmn1r222 UTSW 13 23232762 missense probably damaging 1.00
R2352:Vmn1r222 UTSW 13 23232513 missense probably benign 0.35
R3079:Vmn1r222 UTSW 13 23232461 missense possibly damaging 0.75
R3080:Vmn1r222 UTSW 13 23232461 missense possibly damaging 0.75
R3963:Vmn1r222 UTSW 13 23232932 missense probably benign 0.01
R4448:Vmn1r222 UTSW 13 23232293 missense probably benign 0.11
R4448:Vmn1r222 UTSW 13 23232660 missense probably damaging 0.99
R4979:Vmn1r222 UTSW 13 23232432 missense possibly damaging 0.78
R5054:Vmn1r222 UTSW 13 23232731 missense probably damaging 0.98
R5182:Vmn1r222 UTSW 13 23232497 missense probably damaging 1.00
R5230:Vmn1r222 UTSW 13 23233002 missense probably benign
R5462:Vmn1r222 UTSW 13 23232875 missense probably benign 0.05
R5611:Vmn1r222 UTSW 13 23232573 missense probably damaging 1.00
R5677:Vmn1r222 UTSW 13 23232780 missense probably damaging 1.00
R6298:Vmn1r222 UTSW 13 23232795 missense probably benign 0.15
R6655:Vmn1r222 UTSW 13 23232716 missense probably damaging 1.00
R6748:Vmn1r222 UTSW 13 23232947 missense probably benign 0.00
R6912:Vmn1r222 UTSW 13 23232204 missense probably benign 0.44
R7764:Vmn1r222 UTSW 13 23232359 missense probably damaging 1.00
Z1177:Vmn1r222 UTSW 13 23232460 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATCGCATAACCAAGGGTCAG -3'
(R):5'- TGTGAACCTAATCCATTCTACCAC -3'

Sequencing Primer
(F):5'- TAACCAAGGGTCAGAAACTCATG -3'
(R):5'- TCCATTCTACCACAAATACAAGACTG -3'
Posted On2019-11-12