Incidental Mutation 'R7663:Krt79'
ID591742
Institutional Source Beutler Lab
Gene Symbol Krt79
Ensembl Gene ENSMUSG00000061397
Gene Namekeratin 79
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7663 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101929332-101940324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101931843 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 306 (D306G)
Ref Sequence ENSEMBL: ENSMUSP00000023799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023799]
Predicted Effect probably damaging
Transcript: ENSMUST00000023799
AA Change: D306G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023799
Gene: ENSMUSG00000061397
AA Change: D306G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 98 6.6e-11 PFAM
Pfam:Keratin_2_head 73 135 1.2e-21 PFAM
Filament 138 452 7.12e-159 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Meta Mutation Damage Score 0.6907 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,126 T359A probably damaging Het
Abcd4 A C 12: 84,606,129 V433G probably damaging Het
Acot5 C A 12: 84,069,581 R39S probably damaging Het
Actl9 T C 17: 33,433,469 S168P probably damaging Het
Adam15 A G 3: 89,345,806 L237P probably damaging Het
Ahctf1 T C 1: 179,790,314 Q289R possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asah1 C T 8: 41,341,627 R385Q probably damaging Het
AW549877 T C 15: 3,988,683 Y170C probably damaging Het
Bicc1 T C 10: 70,946,590 T607A probably benign Het
Ccdc88a T C 11: 29,498,614 probably null Het
Cdhr4 A T 9: 107,998,772 R750* probably null Het
Cep290 T A 10: 100,554,536 probably null Het
Clca3a1 T A 3: 144,737,036 D749V probably benign Het
Clcn1 C T 6: 42,310,063 P685S possibly damaging Het
Clk1 A G 1: 58,421,160 S104P probably damaging Het
Commd10 T C 18: 47,086,256 V172A probably benign Het
Cyp2c69 A T 19: 39,877,509 C213* probably null Het
Dnah14 A T 1: 181,752,155 probably null Het
Dock2 C T 11: 34,721,027 G170R probably damaging Het
Fam186a T G 15: 99,945,069 H1098P probably benign Het
Flt1 T C 5: 147,655,120 T511A probably benign Het
Fmo1 A C 1: 162,836,297 I221S possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Ginm1 A T 10: 7,775,362 S93R possibly damaging Het
Gm10251 A C 14: 6,675,701 probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gys2 C T 6: 142,459,485 R192H probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hectd4 C A 5: 121,324,031 A987E probably benign Het
Herc2 G A 7: 56,136,685 V1593I probably benign Het
Ighv14-3 T C 12: 114,059,934 T88A probably benign Het
Jag2 T C 12: 112,913,666 D695G probably damaging Het
Kazn A T 4: 142,104,898 D663E Het
Lama1 T A 17: 67,780,880 C1498S Het
Ldb1 T C 19: 46,035,524 Y141C probably damaging Het
Lmnb2 T A 10: 80,904,739 E336V probably damaging Het
Lrp1b T A 2: 42,653,035 probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 T A 14: 103,191,609 Y2377F probably damaging Het
Neb T A 2: 52,230,047 Y721F Het
Ntf3 A G 6: 126,101,815 S243P probably damaging Het
Olfr1195 G C 2: 88,683,352 P127A probably damaging Het
Olfr1480 G T 19: 13,530,445 M301I probably damaging Het
Olfr593 T C 7: 103,212,445 M195T possibly damaging Het
Pdk1 G A 2: 71,875,398 probably null Het
Pdzd2 A G 15: 12,373,203 V2282A probably damaging Het
Piwil1 T C 5: 128,747,433 F517L probably benign Het
Plch2 T A 4: 154,991,162 T738S probably damaging Het
Plekhm3 G A 1: 64,883,208 R603W probably damaging Het
Pltp A T 2: 164,857,006 probably null Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Psmb3 G T 11: 97,712,492 R177L probably damaging Het
Ralgapa2 A G 2: 146,418,415 V764A probably benign Het
Rel T C 11: 23,742,713 D440G probably benign Het
Rims2 T A 15: 39,507,026 V952E probably damaging Het
Samd4b G T 7: 28,423,500 C44* probably null Het
Slamf8 C A 1: 172,588,038 V78F possibly damaging Het
Slc35a1 A T 4: 34,675,493 N111K possibly damaging Het
Slc7a5 A T 8: 121,887,535 Y264* probably null Het
Srsf2 T C 11: 116,852,294 S134G unknown Het
Stag1 T A 9: 100,738,138 M98K probably damaging Het
Trib1 T C 15: 59,651,713 S199P probably damaging Het
Txnip T C 3: 96,559,837 S276P possibly damaging Het
Vmn1r194 C T 13: 22,244,741 T176I not run Het
Vmn1r222 A G 13: 23,232,431 L204P possibly damaging Het
Vmn2r63 T A 7: 42,927,042 H449L probably benign Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vmn2r87 T A 10: 130,472,185 H728L probably damaging Het
Zfp69 G A 4: 120,935,126 A151V probably benign Het
Zfp738 A G 13: 67,683,401 probably null Het
Zfp974 T C 7: 27,911,685 E205G possibly damaging Het
Other mutations in Krt79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Krt79 APN 15 101940166 missense probably damaging 0.98
IGL00546:Krt79 APN 15 101929873 missense probably benign 0.00
IGL01595:Krt79 APN 15 101931771 missense probably damaging 0.98
IGL02193:Krt79 APN 15 101939905 missense possibly damaging 0.59
R0639:Krt79 UTSW 15 101931548 nonsense probably null
R0980:Krt79 UTSW 15 101938007 missense probably damaging 1.00
R1839:Krt79 UTSW 15 101937938 missense possibly damaging 0.81
R4624:Krt79 UTSW 15 101939806 missense possibly damaging 0.92
R4745:Krt79 UTSW 15 101930684 missense probably damaging 1.00
R5203:Krt79 UTSW 15 101929740 missense unknown
R5382:Krt79 UTSW 15 101931440 missense probably benign 0.09
R5568:Krt79 UTSW 15 101929785 missense probably damaging 0.99
R6902:Krt79 UTSW 15 101931879 missense probably benign 0.08
R6916:Krt79 UTSW 15 101936170 missense probably benign 0.01
R6998:Krt79 UTSW 15 101937872 missense probably benign
R7009:Krt79 UTSW 15 101931441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGAGCTGAGTGCACCAG -3'
(R):5'- TCCAGTGGTAGATTCTTTCCAGGG -3'

Sequencing Primer
(F):5'- AGGTCCCAGAGCTCTGAG -3'
(R):5'- AAGCCTAGGATGTCCCTCTGAG -3'
Posted On2019-11-12