Incidental Mutation 'R7664:Muc16'
ID591794
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7664 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18607722 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 6304 (I6304N)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: I6304N

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A T 8: 3,386,390 E228V probably damaging Het
Acaca C T 11: 84,245,349 T510I probably damaging Het
Akap12 G T 10: 4,353,748 W291L probably damaging Het
Akip1 A T 7: 109,708,980 I152F probably benign Het
Alpk2 T A 18: 65,307,002 Y440F probably benign Het
Aox3 A G 1: 58,119,539 T90A probably damaging Het
B4galnt4 A G 7: 141,067,713 K405E probably damaging Het
BC034090 T C 1: 155,241,631 E247G probably damaging Het
Camkk2 A T 5: 122,756,582 F216I unknown Het
Carm1 A C 9: 21,586,990 K430T probably benign Het
Ccdc13 A G 9: 121,814,213 V374A probably benign Het
Cdh26 T A 2: 178,470,042 M465K probably benign Het
Ceacam10 A T 7: 24,778,332 M91L probably benign Het
Chrnb1 T C 11: 69,787,024 T301A possibly damaging Het
Clec4a3 A G 6: 122,966,422 D101G probably benign Het
Cmss1 G A 16: 57,317,947 P59S probably benign Het
Crhr1 T A 11: 104,169,142 F138L probably benign Het
Cxcl5 A T 5: 90,760,031 I107F probably damaging Het
Cxcr1 A G 1: 74,192,675 S63P probably damaging Het
Cxcr5 A G 9: 44,513,310 L350P probably benign Het
D5Ertd579e A T 5: 36,614,617 H811Q probably benign Het
Ddx46 T G 13: 55,659,051 I499S probably damaging Het
Ddx51 T G 5: 110,656,919 probably null Het
Dnaja1 C T 4: 40,724,090 P84S probably benign Het
Dnajc27 A G 12: 4,103,132 K203E possibly damaging Het
Fam107b T A 2: 3,570,710 C24S probably damaging Het
Fancg T C 4: 43,010,066 K11R probably benign Het
Fnip1 T C 11: 54,466,125 L44P probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Heca A T 10: 17,902,370 L493Q probably damaging Het
Hrh2 C T 13: 54,214,856 P284S probably damaging Het
Ifnar1 C G 16: 91,495,194 A141G probably damaging Het
Igkv6-32 T A 6: 70,074,298 T25S probably damaging Het
Inppl1 T C 7: 101,830,097 H525R probably damaging Het
Itga2b A G 11: 102,460,840 L553P probably damaging Het
Itgbl1 A G 14: 123,846,550 Y280C probably damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kcnh4 G T 11: 100,750,322 L434M probably damaging Het
Klhl14 T C 18: 21,554,649 D572G probably damaging Het
Klhl41 T A 2: 69,670,717 L174Q probably damaging Het
Lrp2 T G 2: 69,506,732 H1232P probably damaging Het
Lyar A G 5: 38,230,817 E229G probably benign Het
Mark4 A T 7: 19,443,226 L226Q probably damaging Het
Mcm8 A G 2: 132,843,533 K823R probably damaging Het
Mfsd6 A T 1: 52,709,053 S218T probably benign Het
Mlip A T 9: 77,138,546 I884N possibly damaging Het
Mmrn1 A G 6: 60,976,705 T657A probably benign Het
Morc2b A G 17: 33,136,402 Y799H probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Naaladl2 T C 3: 24,058,139 Y593C probably damaging Het
Ncor1 T C 11: 62,398,328 E341G probably damaging Het
Nudt3 A G 17: 27,623,175 L4P probably benign Het
Odf2l T A 3: 145,148,584 H493Q probably benign Het
Ost4 A C 5: 30,907,663 probably null Het
Patj A T 4: 98,496,950 Q840L possibly damaging Het
Pcdh20 T A 14: 88,469,367 T166S probably benign Het
Pcdhb4 T A 18: 37,309,240 D534E probably damaging Het
Pik3ap1 T C 19: 41,321,630 D417G possibly damaging Het
Ppwd1 A T 13: 104,220,290 V239E probably damaging Het
Prdm9 T A 17: 15,555,571 Y206F probably damaging Het
Ranbp6 A G 19: 29,812,076 V292A possibly damaging Het
Rgs21 T A 1: 144,541,249 M22L probably benign Het
Rnf17 A T 14: 56,438,878 I399F probably damaging Het
Rph3a T A 5: 120,961,276 Q184L probably benign Het
Scrn3 T C 2: 73,319,370 Y137H possibly damaging Het
Sec14l4 C A 11: 4,044,178 Y342* probably null Het
Serpinb11 G A 1: 107,379,988 G383D probably damaging Het
Sf3b1 A G 1: 54,987,467 V1261A probably damaging Het
Sh3tc2 C T 18: 62,014,971 Q1251* probably null Het
Skor1 A T 9: 63,141,763 D845E probably benign Het
Slc39a7 A G 17: 34,029,577 L364P probably damaging Het
Snrpn T C 7: 59,987,491 I26V probably benign Het
Spag9 T C 11: 94,102,160 probably null Het
Srrm2 T C 17: 23,820,981 S2200P probably damaging Het
Stx11 T C 10: 12,941,326 E218G probably damaging Het
Tmem151b T C 17: 45,545,935 N193S probably damaging Het
Tmem87b A T 2: 128,849,054 D525V possibly damaging Het
Ubtfl1 A T 9: 18,409,486 R103S possibly damaging Het
Vmn1r196 T A 13: 22,293,762 D190E probably damaging Het
Vmn2r67 T A 7: 85,155,811 D31V probably benign Het
Zbtb22 T A 17: 33,918,579 M566K probably benign Het
Zfp568 A T 7: 30,022,290 H220L probably benign Het
Zfp974 A T 7: 27,910,712 S529R possibly damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7928:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7932:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7948:Muc16 UTSW 9 18642490 missense not run
R7967:Muc16 UTSW 9 18642694 missense unknown
R7968:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7969:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7982:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7987:Muc16 UTSW 9 18655650 missense unknown
R7998:Muc16 UTSW 9 18639892 missense not run
R8014:Muc16 UTSW 9 18654875 missense not run
R8033:Muc16 UTSW 9 18636606 missense not run
R8052:Muc16 UTSW 9 18659051 missense not run
R8058:Muc16 UTSW 9 18660002 nonsense probably null
Z1177:Muc16 UTSW 9 18537571 missense not run
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGTCCATCCAAGGTCATAGG -3'
(R):5'- GCTGGGCCCTTATACCTTAGAC -3'

Sequencing Primer
(F):5'- GGACCTGTGCATCTACAATTAGG -3'
(R):5'- CAAGAACAGCCTTTACATCAATGGTG -3'
Posted On2019-11-12