Incidental Mutation 'R7664:Carm1'
ID591795
Institutional Source Beutler Lab
Gene Symbol Carm1
Ensembl Gene ENSMUSG00000032185
Gene Namecoactivator-associated arginine methyltransferase 1
SynonymsPrmt4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7664 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21546894-21592623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21586990 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 430 (K430T)
Ref Sequence ENSEMBL: ENSMUSP00000034703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034700] [ENSMUST00000034703] [ENSMUST00000078572] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032] [ENSMUST00000180365] [ENSMUST00000213809]
PDB Structure
CRYSTAL STRUCTURE OF COACTIVATOR-ASSOCIATED ARGININE METHYLTRANSFERASE 1 (CARM1), IN COMPLEX WITH S-ADENOSYL-HOMOCYSTEINE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF COACTIVATOR-ASSOCIATED ARGININE METHYLTRANSFERASE 1 (CARM1), UNLIGANDED [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034700
SMART Domains Protein: ENSMUSP00000034700
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034703
AA Change: K430T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185
AA Change: K430T

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078572
SMART Domains Protein: ENSMUSP00000077649
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115394
AA Change: K430T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185
AA Change: K430T

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115395
AA Change: K430T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185
AA Change: K430T

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130032
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180365
SMART Domains Protein: ENSMUSP00000136463
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213809
Predicted Effect probably benign
Transcript: ENSMUST00000216160
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts specifically on histones and other chromatin-associated proteins and is involved in regulation of gene expression. The enzyme may act in association with other proteins or within multi-protein complexes and may play a role in cell type-specific functions and cell lineage specification. A related pseudogene is located on chromosome 9. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null fetuses are small and die perinatally, whereas heterozygotes are born at the expected Mendelian ratio but show decreased survival through weaning. Mice homozygous for a kinase null allele exhibit neonatal lethality, arrested T cell development, and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A T 8: 3,386,390 E228V probably damaging Het
Acaca C T 11: 84,245,349 T510I probably damaging Het
Akap12 G T 10: 4,353,748 W291L probably damaging Het
Akip1 A T 7: 109,708,980 I152F probably benign Het
Alpk2 T A 18: 65,307,002 Y440F probably benign Het
Aox3 A G 1: 58,119,539 T90A probably damaging Het
B4galnt4 A G 7: 141,067,713 K405E probably damaging Het
BC034090 T C 1: 155,241,631 E247G probably damaging Het
Camkk2 A T 5: 122,756,582 F216I unknown Het
Ccdc13 A G 9: 121,814,213 V374A probably benign Het
Cdh26 T A 2: 178,470,042 M465K probably benign Het
Ceacam10 A T 7: 24,778,332 M91L probably benign Het
Chrnb1 T C 11: 69,787,024 T301A possibly damaging Het
Clec4a3 A G 6: 122,966,422 D101G probably benign Het
Cmss1 G A 16: 57,317,947 P59S probably benign Het
Crhr1 T A 11: 104,169,142 F138L probably benign Het
Cxcl5 A T 5: 90,760,031 I107F probably damaging Het
Cxcr1 A G 1: 74,192,675 S63P probably damaging Het
Cxcr5 A G 9: 44,513,310 L350P probably benign Het
D5Ertd579e A T 5: 36,614,617 H811Q probably benign Het
Ddx46 T G 13: 55,659,051 I499S probably damaging Het
Ddx51 T G 5: 110,656,919 probably null Het
Dnaja1 C T 4: 40,724,090 P84S probably benign Het
Dnajc27 A G 12: 4,103,132 K203E possibly damaging Het
Fam107b T A 2: 3,570,710 C24S probably damaging Het
Fancg T C 4: 43,010,066 K11R probably benign Het
Fnip1 T C 11: 54,466,125 L44P probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Heca A T 10: 17,902,370 L493Q probably damaging Het
Hrh2 C T 13: 54,214,856 P284S probably damaging Het
Ifnar1 C G 16: 91,495,194 A141G probably damaging Het
Igkv6-32 T A 6: 70,074,298 T25S probably damaging Het
Inppl1 T C 7: 101,830,097 H525R probably damaging Het
Itga2b A G 11: 102,460,840 L553P probably damaging Het
Itgbl1 A G 14: 123,846,550 Y280C probably damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kcnh4 G T 11: 100,750,322 L434M probably damaging Het
Klhl14 T C 18: 21,554,649 D572G probably damaging Het
Klhl41 T A 2: 69,670,717 L174Q probably damaging Het
Lrp2 T G 2: 69,506,732 H1232P probably damaging Het
Lyar A G 5: 38,230,817 E229G probably benign Het
Mark4 A T 7: 19,443,226 L226Q probably damaging Het
Mcm8 A G 2: 132,843,533 K823R probably damaging Het
Mfsd6 A T 1: 52,709,053 S218T probably benign Het
Mlip A T 9: 77,138,546 I884N possibly damaging Het
Mmrn1 A G 6: 60,976,705 T657A probably benign Het
Morc2b A G 17: 33,136,402 Y799H probably benign Het
Muc16 A T 9: 18,607,722 I6304N probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Naaladl2 T C 3: 24,058,139 Y593C probably damaging Het
Ncor1 T C 11: 62,398,328 E341G probably damaging Het
Nrg1 G T 8: 32,009,141 probably null Het
Nudt3 A G 17: 27,623,175 L4P probably benign Het
Odf2l T A 3: 145,148,584 H493Q probably benign Het
Ost4 A C 5: 30,907,663 probably null Het
Patj A T 4: 98,496,950 Q840L possibly damaging Het
Pcdh20 T A 14: 88,469,367 T166S probably benign Het
Pcdhb4 T A 18: 37,309,240 D534E probably damaging Het
Pik3ap1 T C 19: 41,321,630 D417G possibly damaging Het
Ppwd1 A T 13: 104,220,290 V239E probably damaging Het
Prdm9 T A 17: 15,555,571 Y206F probably damaging Het
Ranbp6 A G 19: 29,812,076 V292A possibly damaging Het
Rgs21 T A 1: 144,541,249 M22L probably benign Het
Rnf17 A T 14: 56,438,878 I399F probably damaging Het
Rph3a T A 5: 120,961,276 Q184L probably benign Het
Scrn3 T C 2: 73,319,370 Y137H possibly damaging Het
Sec14l4 C A 11: 4,044,178 Y342* probably null Het
Serpinb11 G A 1: 107,379,988 G383D probably damaging Het
Sf3b1 A G 1: 54,987,467 V1261A probably damaging Het
Sh3tc2 C T 18: 62,014,971 Q1251* probably null Het
Skor1 A T 9: 63,141,763 D845E probably benign Het
Slc39a7 A G 17: 34,029,577 L364P probably damaging Het
Snrpn T C 7: 59,987,491 I26V probably benign Het
Snx5 A T 2: 144,258,004 probably null Het
Spag9 T C 11: 94,102,160 probably null Het
Srrm2 T C 17: 23,820,981 S2200P probably damaging Het
Stx11 T C 10: 12,941,326 E218G probably damaging Het
Tmem151b T C 17: 45,545,935 N193S probably damaging Het
Tmem87b A T 2: 128,849,054 D525V possibly damaging Het
Ubtfl1 A T 9: 18,409,486 R103S possibly damaging Het
Vmn1r196 T A 13: 22,293,762 D190E probably damaging Het
Vmn2r67 T A 7: 85,155,811 D31V probably benign Het
Zbtb22 T A 17: 33,918,579 M566K probably benign Het
Zfp568 A T 7: 30,022,290 H220L probably benign Het
Zfp974 A T 7: 27,910,712 S529R possibly damaging Het
Other mutations in Carm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Carm1 APN 9 21587194 missense possibly damaging 0.62
IGL01360:Carm1 APN 9 21587302 missense probably benign 0.19
IGL01401:Carm1 APN 9 21569582 critical splice donor site probably null
IGL02218:Carm1 APN 9 21569512 missense probably damaging 1.00
IGL02436:Carm1 APN 9 21579462 missense probably damaging 1.00
IGL02601:Carm1 APN 9 21586908 missense probably damaging 1.00
R0551:Carm1 UTSW 9 21580491 splice site probably null
R0580:Carm1 UTSW 9 21583584 missense probably damaging 1.00
R0724:Carm1 UTSW 9 21587374 missense probably damaging 1.00
R0883:Carm1 UTSW 9 21569591 splice site probably benign
R1390:Carm1 UTSW 9 21579493 missense probably damaging 1.00
R1713:Carm1 UTSW 9 21586489 missense probably damaging 0.97
R1950:Carm1 UTSW 9 21574516 missense probably benign 0.01
R1960:Carm1 UTSW 9 21580310 missense probably benign 0.40
R2402:Carm1 UTSW 9 21583540 missense probably damaging 1.00
R2512:Carm1 UTSW 9 21575412 critical splice acceptor site probably null
R2520:Carm1 UTSW 9 21583597 splice site probably null
R2939:Carm1 UTSW 9 21579396 splice site probably null
R2940:Carm1 UTSW 9 21579396 splice site probably null
R3081:Carm1 UTSW 9 21579396 splice site probably null
R3407:Carm1 UTSW 9 21586182 missense probably damaging 1.00
R3434:Carm1 UTSW 9 21569473 missense probably damaging 1.00
R3808:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R4504:Carm1 UTSW 9 21569526 missense probably damaging 1.00
R4700:Carm1 UTSW 9 21587184 missense probably benign 0.12
R5019:Carm1 UTSW 9 21579511 critical splice donor site probably null
R5362:Carm1 UTSW 9 21587359 missense probably benign 0.03
R5661:Carm1 UTSW 9 21586999 missense probably benign 0.10
R5730:Carm1 UTSW 9 21580340 missense probably benign 0.37
R5913:Carm1 UTSW 9 21587552 missense probably benign 0.01
R5928:Carm1 UTSW 9 21575302 intron probably benign
R6370:Carm1 UTSW 9 21587519 missense probably benign 0.11
R6431:Carm1 UTSW 9 21583077 missense probably damaging 1.00
R6555:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R7177:Carm1 UTSW 9 21547027 missense unknown
R7235:Carm1 UTSW 9 21587405 critical splice donor site probably benign
R7249:Carm1 UTSW 9 21586209 missense probably benign
R7576:Carm1 UTSW 9 21586536 critical splice donor site probably null
R7650:Carm1 UTSW 9 21580372 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTTCTAGAGTCCAGCCAGTC -3'
(R):5'- CACCTGTGCCACAATACTGATG -3'

Sequencing Primer
(F):5'- TAGAGTCCAGCCAGTCTTAGC -3'
(R):5'- CCTGTGCCACAATACTGATGTCATAG -3'
Posted On2019-11-12