Incidental Mutation 'R7664:Acaca'
ID 591807
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms LOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7664 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84129672-84401651 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84245349 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 510 (T510I)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
AlphaFold Q5SWU9
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: T510I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: T510I

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: T510I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: T510I

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A T 8: 3,386,390 E228V probably damaging Het
Akap12 G T 10: 4,353,748 W291L probably damaging Het
Akip1 A T 7: 109,708,980 I152F probably benign Het
Alpk2 T A 18: 65,307,002 Y440F probably benign Het
Aox3 A G 1: 58,119,539 T90A probably damaging Het
B4galnt4 A G 7: 141,067,713 K405E probably damaging Het
BC034090 T C 1: 155,241,631 E247G probably damaging Het
Camkk2 A T 5: 122,756,582 F216I unknown Het
Carm1 A C 9: 21,586,990 K430T probably benign Het
Ccdc13 A G 9: 121,814,213 V374A probably benign Het
Cdh26 T A 2: 178,470,042 M465K probably benign Het
Ceacam10 A T 7: 24,778,332 M91L probably benign Het
Chrnb1 T C 11: 69,787,024 T301A possibly damaging Het
Clec4a3 A G 6: 122,966,422 D101G probably benign Het
Cmss1 G A 16: 57,317,947 P59S probably benign Het
Crhr1 T A 11: 104,169,142 F138L probably benign Het
Cxcl5 A T 5: 90,760,031 I107F probably damaging Het
Cxcr1 A G 1: 74,192,675 S63P probably damaging Het
Cxcr5 A G 9: 44,513,310 L350P probably benign Het
D5Ertd579e A T 5: 36,614,617 H811Q probably benign Het
Ddx46 T G 13: 55,659,051 I499S probably damaging Het
Ddx51 T G 5: 110,656,919 probably null Het
Dnaja1 C T 4: 40,724,090 P84S probably benign Het
Dnajc27 A G 12: 4,103,132 K203E possibly damaging Het
Fam107b T A 2: 3,570,710 C24S probably damaging Het
Fancg T C 4: 43,010,066 K11R probably benign Het
Fnip1 T C 11: 54,466,125 L44P probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Heca A T 10: 17,902,370 L493Q probably damaging Het
Hrh2 C T 13: 54,214,856 P284S probably damaging Het
Ifnar1 C G 16: 91,495,194 A141G probably damaging Het
Igkv6-32 T A 6: 70,074,298 T25S probably damaging Het
Inppl1 T C 7: 101,830,097 H525R probably damaging Het
Itga2b A G 11: 102,460,840 L553P probably damaging Het
Itgbl1 A G 14: 123,846,550 Y280C probably damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kcnh4 G T 11: 100,750,322 L434M probably damaging Het
Klhl14 T C 18: 21,554,649 D572G probably damaging Het
Klhl41 T A 2: 69,670,717 L174Q probably damaging Het
Lrp2 T G 2: 69,506,732 H1232P probably damaging Het
Lyar A G 5: 38,230,817 E229G probably benign Het
Mark4 A T 7: 19,443,226 L226Q probably damaging Het
Mcm8 A G 2: 132,843,533 K823R probably damaging Het
Mfsd6 A T 1: 52,709,053 S218T probably benign Het
Mlip A T 9: 77,138,546 I884N possibly damaging Het
Mmrn1 A G 6: 60,976,705 T657A probably benign Het
Morc2b A G 17: 33,136,402 Y799H probably benign Het
Muc16 A T 9: 18,607,722 I6304N probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Naaladl2 T C 3: 24,058,139 Y593C probably damaging Het
Ncor1 T C 11: 62,398,328 E341G probably damaging Het
Nrg1 G T 8: 32,009,141 probably null Het
Nudt3 A G 17: 27,623,175 L4P probably benign Het
Odf2l T A 3: 145,148,584 H493Q probably benign Het
Ost4 A C 5: 30,907,663 probably null Het
Patj A T 4: 98,496,950 Q840L possibly damaging Het
Pcdh20 T A 14: 88,469,367 T166S probably benign Het
Pcdhb4 T A 18: 37,309,240 D534E probably damaging Het
Pik3ap1 T C 19: 41,321,630 D417G possibly damaging Het
Ppwd1 A T 13: 104,220,290 V239E probably damaging Het
Prdm9 T A 17: 15,555,571 Y206F probably damaging Het
Ranbp6 A G 19: 29,812,076 V292A possibly damaging Het
Rgs21 T A 1: 144,541,249 M22L probably benign Het
Rnf17 A T 14: 56,438,878 I399F probably damaging Het
Rph3a T A 5: 120,961,276 Q184L probably benign Het
Scrn3 T C 2: 73,319,370 Y137H possibly damaging Het
Sec14l4 C A 11: 4,044,178 Y342* probably null Het
Serpinb11 G A 1: 107,379,988 G383D probably damaging Het
Sf3b1 A G 1: 54,987,467 V1261A probably damaging Het
Sh3tc2 C T 18: 62,014,971 Q1251* probably null Het
Skor1 A T 9: 63,141,763 D845E probably benign Het
Slc39a7 A G 17: 34,029,577 L364P probably damaging Het
Snrpn T C 7: 59,987,491 I26V probably benign Het
Snx5 A T 2: 144,258,004 probably null Het
Spag9 T C 11: 94,102,160 probably null Het
Srrm2 T C 17: 23,820,981 S2200P probably damaging Het
Stx11 T C 10: 12,941,326 E218G probably damaging Het
Tmem151b T C 17: 45,545,935 N193S probably damaging Het
Tmem87b A T 2: 128,849,054 D525V possibly damaging Het
Ubtfl1 A T 9: 18,409,486 R103S possibly damaging Het
Vmn1r196 T A 13: 22,293,762 D190E probably damaging Het
Vmn2r67 T A 7: 85,155,811 D31V probably benign Het
Zbtb22 T A 17: 33,918,579 M566K probably benign Het
Zfp568 A T 7: 30,022,290 H220L probably benign Het
Zfp974 A T 7: 27,910,712 S529R possibly damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
effervescence UTSW 11 84262474 missense probably benign 0.41
fizz UTSW 11 84245856 missense probably damaging 0.98
greenhouse UTSW 11 84338356 missense probably damaging 1.00
Serene UTSW 11 84311409 splice site probably null
Tranquil UTSW 11 84280461 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 splice site probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7898:Acaca UTSW 11 84364449 critical splice donor site probably null
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7915:Acaca UTSW 11 84276588 missense probably benign
R7956:Acaca UTSW 11 84320580 missense probably damaging 0.98
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
R8545:Acaca UTSW 11 84345968 missense probably damaging 1.00
R8722:Acaca UTSW 11 84338457 missense possibly damaging 0.85
R9005:Acaca UTSW 11 84371584 missense probably damaging 0.99
R9130:Acaca UTSW 11 84311319 missense probably damaging 1.00
R9397:Acaca UTSW 11 84368725 missense probably damaging 1.00
R9489:Acaca UTSW 11 84293016 missense probably benign 0.01
R9540:Acaca UTSW 11 84243411 missense probably damaging 1.00
R9593:Acaca UTSW 11 84380513 nonsense probably null
R9605:Acaca UTSW 11 84293016 missense probably benign 0.01
R9634:Acaca UTSW 11 84293990 missense probably benign 0.00
R9720:Acaca UTSW 11 84263357 missense probably damaging 1.00
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATAGCTCCCCTCTGTTAAGG -3'
(R):5'- CAAATCACGGATGCTTCCTG -3'

Sequencing Primer
(F):5'- GGGACTGTGGAAAGTGACATGTG -3'
(R):5'- AATCACGGATGCTTCCTGAGTGAC -3'
Posted On 2019-11-12