Incidental Mutation 'R7664:Alpk2'
ID591832
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
MMRRC Submission
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7664 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65307002 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 440 (Y440F)
Ref Sequence ENSEMBL: ENSMUSP00000114658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably benign
Transcript: ENSMUST00000035548
AA Change: Y907F

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: Y907F

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141250
AA Change: Y440F

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: Y440F

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (83/84)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A T 8: 3,386,390 E228V probably damaging Het
Acaca C T 11: 84,245,349 T510I probably damaging Het
Akap12 G T 10: 4,353,748 W291L probably damaging Het
Akip1 A T 7: 109,708,980 I152F probably benign Het
Aox3 A G 1: 58,119,539 T90A probably damaging Het
B4galnt4 A G 7: 141,067,713 K405E probably damaging Het
BC034090 T C 1: 155,241,631 E247G probably damaging Het
Camkk2 A T 5: 122,756,582 F216I unknown Het
Carm1 A C 9: 21,586,990 K430T probably benign Het
Ccdc13 A G 9: 121,814,213 V374A probably benign Het
Cdh26 T A 2: 178,470,042 M465K probably benign Het
Ceacam10 A T 7: 24,778,332 M91L probably benign Het
Chrnb1 T C 11: 69,787,024 T301A possibly damaging Het
Clec4a3 A G 6: 122,966,422 D101G probably benign Het
Cmss1 G A 16: 57,317,947 P59S probably benign Het
Crhr1 T A 11: 104,169,142 F138L probably benign Het
Cxcl5 A T 5: 90,760,031 I107F probably damaging Het
Cxcr1 A G 1: 74,192,675 S63P probably damaging Het
Cxcr5 A G 9: 44,513,310 L350P probably benign Het
D5Ertd579e A T 5: 36,614,617 H811Q probably benign Het
Ddx46 T G 13: 55,659,051 I499S probably damaging Het
Ddx51 T G 5: 110,656,919 probably null Het
Dnaja1 C T 4: 40,724,090 P84S probably benign Het
Dnajc27 A G 12: 4,103,132 K203E possibly damaging Het
Fam107b T A 2: 3,570,710 C24S probably damaging Het
Fancg T C 4: 43,010,066 K11R probably benign Het
Fnip1 T C 11: 54,466,125 L44P probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Heca A T 10: 17,902,370 L493Q probably damaging Het
Hrh2 C T 13: 54,214,856 P284S probably damaging Het
Ifnar1 C G 16: 91,495,194 A141G probably damaging Het
Igkv6-32 T A 6: 70,074,298 T25S probably damaging Het
Inppl1 T C 7: 101,830,097 H525R probably damaging Het
Itga2b A G 11: 102,460,840 L553P probably damaging Het
Itgbl1 A G 14: 123,846,550 Y280C probably damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kcnh4 G T 11: 100,750,322 L434M probably damaging Het
Klhl14 T C 18: 21,554,649 D572G probably damaging Het
Klhl41 T A 2: 69,670,717 L174Q probably damaging Het
Lrp2 T G 2: 69,506,732 H1232P probably damaging Het
Lyar A G 5: 38,230,817 E229G probably benign Het
Mark4 A T 7: 19,443,226 L226Q probably damaging Het
Mcm8 A G 2: 132,843,533 K823R probably damaging Het
Mfsd6 A T 1: 52,709,053 S218T probably benign Het
Mlip A T 9: 77,138,546 I884N possibly damaging Het
Mmrn1 A G 6: 60,976,705 T657A probably benign Het
Morc2b A G 17: 33,136,402 Y799H probably benign Het
Muc16 A T 9: 18,607,722 I6304N probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Naaladl2 T C 3: 24,058,139 Y593C probably damaging Het
Ncor1 T C 11: 62,398,328 E341G probably damaging Het
Nrg1 G T 8: 32,009,141 probably null Het
Nudt3 A G 17: 27,623,175 L4P probably benign Het
Odf2l T A 3: 145,148,584 H493Q probably benign Het
Ost4 A C 5: 30,907,663 probably null Het
Patj A T 4: 98,496,950 Q840L possibly damaging Het
Pcdh20 T A 14: 88,469,367 T166S probably benign Het
Pcdhb4 T A 18: 37,309,240 D534E probably damaging Het
Pik3ap1 T C 19: 41,321,630 D417G possibly damaging Het
Ppwd1 A T 13: 104,220,290 V239E probably damaging Het
Prdm9 T A 17: 15,555,571 Y206F probably damaging Het
Ranbp6 A G 19: 29,812,076 V292A possibly damaging Het
Rgs21 T A 1: 144,541,249 M22L probably benign Het
Rnf17 A T 14: 56,438,878 I399F probably damaging Het
Rph3a T A 5: 120,961,276 Q184L probably benign Het
Scrn3 T C 2: 73,319,370 Y137H possibly damaging Het
Sec14l4 C A 11: 4,044,178 Y342* probably null Het
Serpinb11 G A 1: 107,379,988 G383D probably damaging Het
Sf3b1 A G 1: 54,987,467 V1261A probably damaging Het
Sh3tc2 C T 18: 62,014,971 Q1251* probably null Het
Skor1 A T 9: 63,141,763 D845E probably benign Het
Slc39a7 A G 17: 34,029,577 L364P probably damaging Het
Snrpn T C 7: 59,987,491 I26V probably benign Het
Snx5 A T 2: 144,258,004 probably null Het
Spag9 T C 11: 94,102,160 probably null Het
Srrm2 T C 17: 23,820,981 S2200P probably damaging Het
Stx11 T C 10: 12,941,326 E218G probably damaging Het
Tmem151b T C 17: 45,545,935 N193S probably damaging Het
Tmem87b A T 2: 128,849,054 D525V possibly damaging Het
Ubtfl1 A T 9: 18,409,486 R103S possibly damaging Het
Vmn1r196 T A 13: 22,293,762 D190E probably damaging Het
Vmn2r67 T A 7: 85,155,811 D31V probably benign Het
Zbtb22 T A 17: 33,918,579 M566K probably benign Het
Zfp568 A T 7: 30,022,290 H220L probably benign Het
Zfp974 A T 7: 27,910,712 S529R possibly damaging Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65304513 missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65266277 nonsense probably null
R7167:Alpk2 UTSW 18 65306978 missense probably benign 0.40
R7225:Alpk2 UTSW 18 65305199 missense probably benign 0.00
R7409:Alpk2 UTSW 18 65306952 missense probably benign 0.01
R7533:Alpk2 UTSW 18 65304603 missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65306816 missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65300073 missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65304566 missense probably damaging 1.00
R7711:Alpk2 UTSW 18 65306484 missense probably benign
R7722:Alpk2 UTSW 18 65350157 missense probably damaging 1.00
R7783:Alpk2 UTSW 18 65306254 nonsense probably null
R7806:Alpk2 UTSW 18 65349416 missense probably benign
R8024:Alpk2 UTSW 18 65305035 missense probably benign 0.01
R8043:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65350346 missense probably benign 0.15
R8171:Alpk2 UTSW 18 65305983 missense probably benign 0.00
R8280:Alpk2 UTSW 18 65307203 missense probably benign
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65305611 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCGACATTAGCAGTTGATTCGG -3'
(R):5'- TCTCCTGACAAGATACTGGCTG -3'

Sequencing Primer
(F):5'- ACATTAGCAGTTGATTCGGCTGAC -3'
(R):5'- GTTCTACAGACACAAGGTTCTGAGC -3'
Posted On2019-11-12