Incidental Mutation 'R7664:Pik3ap1'
ID591834
Institutional Source Beutler Lab
Gene Symbol Pik3ap1
Ensembl Gene ENSMUSG00000025017
Gene Namephosphoinositide-3-kinase adaptor protein 1
SynonymsBCAP, 1810044J04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7664 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41274218-41385070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41321630 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 417 (D417G)
Ref Sequence ENSEMBL: ENSMUSP00000052777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059672
AA Change: D417G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052777
Gene: ENSMUSG00000025017
AA Change: D417G

DomainStartEndE-ValueType
DBB 180 319 8.55e-75 SMART
SCOP:d1bd8__ 331 396 8e-5 SMART
Blast:ANK 336 365 1e-7 BLAST
low complexity region 533 552 N/A INTRINSIC
low complexity region 716 740 N/A INTRINSIC
low complexity region 802 808 N/A INTRINSIC
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (83/84)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in B cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A T 8: 3,386,390 E228V probably damaging Het
Acaca C T 11: 84,245,349 T510I probably damaging Het
Akap12 G T 10: 4,353,748 W291L probably damaging Het
Akip1 A T 7: 109,708,980 I152F probably benign Het
Alpk2 T A 18: 65,307,002 Y440F probably benign Het
Aox3 A G 1: 58,119,539 T90A probably damaging Het
B4galnt4 A G 7: 141,067,713 K405E probably damaging Het
BC034090 T C 1: 155,241,631 E247G probably damaging Het
Camkk2 A T 5: 122,756,582 F216I unknown Het
Carm1 A C 9: 21,586,990 K430T probably benign Het
Ccdc13 A G 9: 121,814,213 V374A probably benign Het
Cdh26 T A 2: 178,470,042 M465K probably benign Het
Ceacam10 A T 7: 24,778,332 M91L probably benign Het
Chrnb1 T C 11: 69,787,024 T301A possibly damaging Het
Clec4a3 A G 6: 122,966,422 D101G probably benign Het
Cmss1 G A 16: 57,317,947 P59S probably benign Het
Crhr1 T A 11: 104,169,142 F138L probably benign Het
Cxcl5 A T 5: 90,760,031 I107F probably damaging Het
Cxcr1 A G 1: 74,192,675 S63P probably damaging Het
Cxcr5 A G 9: 44,513,310 L350P probably benign Het
D5Ertd579e A T 5: 36,614,617 H811Q probably benign Het
Ddx46 T G 13: 55,659,051 I499S probably damaging Het
Ddx51 T G 5: 110,656,919 probably null Het
Dnaja1 C T 4: 40,724,090 P84S probably benign Het
Dnajc27 A G 12: 4,103,132 K203E possibly damaging Het
Fam107b T A 2: 3,570,710 C24S probably damaging Het
Fancg T C 4: 43,010,066 K11R probably benign Het
Fnip1 T C 11: 54,466,125 L44P probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Heca A T 10: 17,902,370 L493Q probably damaging Het
Hrh2 C T 13: 54,214,856 P284S probably damaging Het
Ifnar1 C G 16: 91,495,194 A141G probably damaging Het
Igkv6-32 T A 6: 70,074,298 T25S probably damaging Het
Inppl1 T C 7: 101,830,097 H525R probably damaging Het
Itga2b A G 11: 102,460,840 L553P probably damaging Het
Itgbl1 A G 14: 123,846,550 Y280C probably damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kcnh4 G T 11: 100,750,322 L434M probably damaging Het
Klhl14 T C 18: 21,554,649 D572G probably damaging Het
Klhl41 T A 2: 69,670,717 L174Q probably damaging Het
Lrp2 T G 2: 69,506,732 H1232P probably damaging Het
Lyar A G 5: 38,230,817 E229G probably benign Het
Mark4 A T 7: 19,443,226 L226Q probably damaging Het
Mcm8 A G 2: 132,843,533 K823R probably damaging Het
Mfsd6 A T 1: 52,709,053 S218T probably benign Het
Mlip A T 9: 77,138,546 I884N possibly damaging Het
Mmrn1 A G 6: 60,976,705 T657A probably benign Het
Morc2b A G 17: 33,136,402 Y799H probably benign Het
Muc16 A T 9: 18,607,722 I6304N probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Naaladl2 T C 3: 24,058,139 Y593C probably damaging Het
Ncor1 T C 11: 62,398,328 E341G probably damaging Het
Nrg1 G T 8: 32,009,141 probably null Het
Nudt3 A G 17: 27,623,175 L4P probably benign Het
Odf2l T A 3: 145,148,584 H493Q probably benign Het
Ost4 A C 5: 30,907,663 probably null Het
Patj A T 4: 98,496,950 Q840L possibly damaging Het
Pcdh20 T A 14: 88,469,367 T166S probably benign Het
Pcdhb4 T A 18: 37,309,240 D534E probably damaging Het
Ppwd1 A T 13: 104,220,290 V239E probably damaging Het
Prdm9 T A 17: 15,555,571 Y206F probably damaging Het
Ranbp6 A G 19: 29,812,076 V292A possibly damaging Het
Rgs21 T A 1: 144,541,249 M22L probably benign Het
Rnf17 A T 14: 56,438,878 I399F probably damaging Het
Rph3a T A 5: 120,961,276 Q184L probably benign Het
Scrn3 T C 2: 73,319,370 Y137H possibly damaging Het
Sec14l4 C A 11: 4,044,178 Y342* probably null Het
Serpinb11 G A 1: 107,379,988 G383D probably damaging Het
Sf3b1 A G 1: 54,987,467 V1261A probably damaging Het
Sh3tc2 C T 18: 62,014,971 Q1251* probably null Het
Skor1 A T 9: 63,141,763 D845E probably benign Het
Slc39a7 A G 17: 34,029,577 L364P probably damaging Het
Snrpn T C 7: 59,987,491 I26V probably benign Het
Snx5 A T 2: 144,258,004 probably null Het
Spag9 T C 11: 94,102,160 probably null Het
Srrm2 T C 17: 23,820,981 S2200P probably damaging Het
Stx11 T C 10: 12,941,326 E218G probably damaging Het
Tmem151b T C 17: 45,545,935 N193S probably damaging Het
Tmem87b A T 2: 128,849,054 D525V possibly damaging Het
Ubtfl1 A T 9: 18,409,486 R103S possibly damaging Het
Vmn1r196 T A 13: 22,293,762 D190E probably damaging Het
Vmn2r67 T A 7: 85,155,811 D31V probably benign Het
Zbtb22 T A 17: 33,918,579 M566K probably benign Het
Zfp568 A T 7: 30,022,290 H220L probably benign Het
Zfp974 A T 7: 27,910,712 S529R possibly damaging Het
Other mutations in Pik3ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Pik3ap1 APN 19 41375890 missense possibly damaging 0.95
IGL01697:Pik3ap1 APN 19 41324579 missense probably damaging 1.00
IGL01743:Pik3ap1 APN 19 41292828 splice site probably benign
IGL02006:Pik3ap1 APN 19 41302593 missense probably benign
IGL02507:Pik3ap1 APN 19 41282012 splice site probably benign
IGL02601:Pik3ap1 APN 19 41302442 missense probably benign 0.08
Canvasback UTSW 19 41321630 missense possibly damaging 0.80
Pintail UTSW 19 41376146 missense probably benign 0.00
sooni UTSW 19 41327909 missense probably damaging 1.00
sothe UTSW 19 41356683 intron probably benign
FR4449:Pik3ap1 UTSW 19 41281946 small insertion probably benign
FR4548:Pik3ap1 UTSW 19 41281945 small insertion probably benign
FR4976:Pik3ap1 UTSW 19 41281945 small insertion probably benign
R0504:Pik3ap1 UTSW 19 41287490 missense probably damaging 1.00
R0505:Pik3ap1 UTSW 19 41324564 missense probably damaging 1.00
R0736:Pik3ap1 UTSW 19 41332319 missense possibly damaging 0.56
R0926:Pik3ap1 UTSW 19 41302525 missense probably benign 0.00
R1521:Pik3ap1 UTSW 19 41321558 missense probably damaging 1.00
R1681:Pik3ap1 UTSW 19 41308529 missense probably damaging 1.00
R1779:Pik3ap1 UTSW 19 41332234 missense probably damaging 1.00
R1924:Pik3ap1 UTSW 19 41302614 missense possibly damaging 0.79
R1945:Pik3ap1 UTSW 19 41274337 missense probably benign
R2327:Pik3ap1 UTSW 19 41296389 missense probably damaging 0.99
R2891:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2892:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2893:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2894:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2918:Pik3ap1 UTSW 19 41302531 missense probably benign 0.00
R4424:Pik3ap1 UTSW 19 41375881 missense probably benign 0.00
R4654:Pik3ap1 UTSW 19 41327909 missense probably damaging 1.00
R4811:Pik3ap1 UTSW 19 41302497 missense possibly damaging 0.67
R4855:Pik3ap1 UTSW 19 41327845 missense probably benign 0.13
R4885:Pik3ap1 UTSW 19 41375926 missense probably benign 0.28
R5119:Pik3ap1 UTSW 19 41281976 missense probably benign 0.18
R5261:Pik3ap1 UTSW 19 41376106 missense probably damaging 1.00
R5274:Pik3ap1 UTSW 19 41281952 missense possibly damaging 0.67
R5655:Pik3ap1 UTSW 19 41298241 missense possibly damaging 0.65
R5862:Pik3ap1 UTSW 19 41332345 missense probably damaging 1.00
R5924:Pik3ap1 UTSW 19 41296456 missense probably damaging 1.00
R6015:Pik3ap1 UTSW 19 41328201 missense probably benign 0.22
R6018:Pik3ap1 UTSW 19 41385016 start gained probably benign
R6515:Pik3ap1 UTSW 19 41376146 missense probably benign 0.00
R6792:Pik3ap1 UTSW 19 41321626 missense probably benign 0.14
R7135:Pik3ap1 UTSW 19 41332321 missense probably damaging 1.00
R7162:Pik3ap1 UTSW 19 41321526 missense probably benign 0.03
R7175:Pik3ap1 UTSW 19 41287490 missense probably damaging 0.98
R7313:Pik3ap1 UTSW 19 41296376 missense possibly damaging 0.93
R7786:Pik3ap1 UTSW 19 41321585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGCAGCAGGACAAAAG -3'
(R):5'- ACAAAGGTTAGAGCTCTGCCAG -3'

Sequencing Primer
(F):5'- GCAGAACCAGGCAGAGCTAC -3'
(R):5'- GCTCTGCCAGGCGAAGAATAC -3'
Posted On2019-11-12