Incidental Mutation 'R7665:Spg11'
ID 591840
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene Name SPG11, spatacsin vesicle trafficking associated
Synonyms 6030465E24Rik, C530005A01Rik, spastic paraplegia 11
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 121884001-121948867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121896748 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1686 (V1686E)
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036450]
AlphaFold Q3UHA3
Predicted Effect probably damaging
Transcript: ENSMUST00000036450
AA Change: V1686E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: V1686E

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Meta Mutation Damage Score 0.1862 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 121,896,041 (GRCm39) missense probably damaging 0.96
IGL00495:Spg11 APN 2 121,924,937 (GRCm39) critical splice donor site probably null
IGL00757:Spg11 APN 2 121,901,440 (GRCm39) missense probably benign 0.05
IGL01304:Spg11 APN 2 121,902,771 (GRCm39) missense probably damaging 1.00
IGL01355:Spg11 APN 2 121,943,637 (GRCm39) missense probably benign
IGL01626:Spg11 APN 2 121,891,452 (GRCm39) missense probably damaging 0.98
IGL01739:Spg11 APN 2 121,945,152 (GRCm39) missense probably damaging 1.00
IGL01835:Spg11 APN 2 121,918,705 (GRCm39) missense probably benign 0.36
IGL02129:Spg11 APN 2 121,926,167 (GRCm39) missense probably damaging 0.99
IGL02178:Spg11 APN 2 121,927,783 (GRCm39) missense probably damaging 1.00
IGL02199:Spg11 APN 2 121,890,034 (GRCm39) missense probably damaging 1.00
IGL02212:Spg11 APN 2 121,938,638 (GRCm39) missense probably benign 0.31
IGL02605:Spg11 APN 2 121,922,741 (GRCm39) missense probably benign 0.00
IGL02635:Spg11 APN 2 121,943,549 (GRCm39) missense possibly damaging 0.52
IGL02743:Spg11 APN 2 121,889,988 (GRCm39) missense probably damaging 0.97
IGL02822:Spg11 APN 2 121,905,015 (GRCm39) missense probably damaging 0.99
IGL02992:Spg11 APN 2 121,888,879 (GRCm39) missense probably damaging 1.00
IGL03010:Spg11 APN 2 121,918,801 (GRCm39) missense probably damaging 0.96
3-1:Spg11 UTSW 2 121,917,371 (GRCm39) missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 121,918,666 (GRCm39) missense probably damaging 0.98
R0131:Spg11 UTSW 2 121,901,449 (GRCm39) missense probably damaging 1.00
R0206:Spg11 UTSW 2 121,886,177 (GRCm39) critical splice donor site probably null
R0208:Spg11 UTSW 2 121,886,177 (GRCm39) critical splice donor site probably null
R0302:Spg11 UTSW 2 121,922,668 (GRCm39) missense possibly damaging 0.90
R0347:Spg11 UTSW 2 121,927,850 (GRCm39) missense probably damaging 0.99
R0357:Spg11 UTSW 2 121,896,713 (GRCm39) splice site probably benign
R0372:Spg11 UTSW 2 121,889,928 (GRCm39) frame shift probably null
R0715:Spg11 UTSW 2 121,915,464 (GRCm39) missense probably benign 0.03
R0927:Spg11 UTSW 2 121,924,968 (GRCm39) missense probably damaging 0.99
R1163:Spg11 UTSW 2 121,901,422 (GRCm39) missense probably damaging 1.00
R1534:Spg11 UTSW 2 121,922,806 (GRCm39) missense probably damaging 1.00
R1555:Spg11 UTSW 2 121,927,858 (GRCm39) missense probably damaging 0.99
R1569:Spg11 UTSW 2 121,932,187 (GRCm39) missense probably damaging 0.99
R1840:Spg11 UTSW 2 121,932,237 (GRCm39) missense probably damaging 1.00
R1929:Spg11 UTSW 2 121,890,688 (GRCm39) missense probably damaging 1.00
R2265:Spg11 UTSW 2 121,938,788 (GRCm39) missense possibly damaging 0.48
R2303:Spg11 UTSW 2 121,899,318 (GRCm39) missense probably damaging 0.99
R2510:Spg11 UTSW 2 121,905,791 (GRCm39) missense probably benign 0.03
R2760:Spg11 UTSW 2 121,927,840 (GRCm39) missense probably damaging 0.99
R2918:Spg11 UTSW 2 121,905,782 (GRCm39) missense probably damaging 0.99
R3195:Spg11 UTSW 2 121,913,879 (GRCm39) critical splice donor site probably null
R3423:Spg11 UTSW 2 121,901,534 (GRCm39) missense probably benign 0.00
R4353:Spg11 UTSW 2 121,943,675 (GRCm39) missense possibly damaging 0.92
R4407:Spg11 UTSW 2 121,905,813 (GRCm39) missense probably benign 0.00
R4644:Spg11 UTSW 2 121,891,510 (GRCm39) missense probably benign 0.03
R4663:Spg11 UTSW 2 121,928,580 (GRCm39) critical splice donor site probably null
R4684:Spg11 UTSW 2 121,895,557 (GRCm39) missense probably damaging 1.00
R4771:Spg11 UTSW 2 121,895,963 (GRCm39) nonsense probably null
R4810:Spg11 UTSW 2 121,890,277 (GRCm39) missense probably damaging 1.00
R4829:Spg11 UTSW 2 121,938,936 (GRCm39) missense probably benign 0.44
R5089:Spg11 UTSW 2 121,945,198 (GRCm39) nonsense probably null
R5362:Spg11 UTSW 2 121,891,481 (GRCm39) missense probably damaging 0.99
R5684:Spg11 UTSW 2 121,923,984 (GRCm39) missense probably damaging 1.00
R5899:Spg11 UTSW 2 121,928,680 (GRCm39) missense possibly damaging 0.67
R5923:Spg11 UTSW 2 121,923,959 (GRCm39) missense probably damaging 0.98
R6052:Spg11 UTSW 2 121,927,837 (GRCm39) missense probably damaging 0.99
R6111:Spg11 UTSW 2 121,923,963 (GRCm39) missense probably damaging 0.98
R6174:Spg11 UTSW 2 121,917,286 (GRCm39) splice site probably null
R6226:Spg11 UTSW 2 121,918,743 (GRCm39) missense possibly damaging 0.69
R6336:Spg11 UTSW 2 121,943,440 (GRCm39) splice site probably null
R6480:Spg11 UTSW 2 121,922,786 (GRCm39) missense probably benign 0.03
R6494:Spg11 UTSW 2 121,943,706 (GRCm39) missense probably damaging 0.98
R6582:Spg11 UTSW 2 121,922,773 (GRCm39) missense probably damaging 0.99
R6714:Spg11 UTSW 2 121,926,212 (GRCm39) missense probably damaging 0.99
R6791:Spg11 UTSW 2 121,923,924 (GRCm39) missense probably damaging 0.99
R6836:Spg11 UTSW 2 121,890,016 (GRCm39) missense probably damaging 1.00
R6928:Spg11 UTSW 2 121,900,385 (GRCm39) missense probably benign 0.37
R7179:Spg11 UTSW 2 121,932,270 (GRCm39) splice site probably null
R7229:Spg11 UTSW 2 121,938,585 (GRCm39) missense probably damaging 0.98
R7337:Spg11 UTSW 2 121,915,474 (GRCm39) missense probably benign 0.09
R7338:Spg11 UTSW 2 121,885,858 (GRCm39) missense probably damaging 1.00
R7351:Spg11 UTSW 2 121,900,412 (GRCm39) missense possibly damaging 0.95
R7378:Spg11 UTSW 2 121,888,910 (GRCm39) missense probably damaging 1.00
R7448:Spg11 UTSW 2 121,924,026 (GRCm39) critical splice acceptor site probably null
R7505:Spg11 UTSW 2 121,905,832 (GRCm39) nonsense probably null
R7685:Spg11 UTSW 2 121,899,361 (GRCm39) missense probably damaging 0.99
R7779:Spg11 UTSW 2 121,901,420 (GRCm39) missense probably damaging 1.00
R7947:Spg11 UTSW 2 121,922,803 (GRCm39) missense probably damaging 1.00
R7958:Spg11 UTSW 2 121,923,426 (GRCm39) splice site probably null
R8024:Spg11 UTSW 2 121,927,802 (GRCm39) missense possibly damaging 0.67
R8033:Spg11 UTSW 2 121,917,432 (GRCm39) missense probably damaging 1.00
R8069:Spg11 UTSW 2 121,943,637 (GRCm39) missense probably benign
R8121:Spg11 UTSW 2 121,900,348 (GRCm39) critical splice donor site probably null
R8252:Spg11 UTSW 2 121,918,820 (GRCm39) splice site probably benign
R8358:Spg11 UTSW 2 121,910,739 (GRCm39) missense possibly damaging 0.69
R8362:Spg11 UTSW 2 121,948,842 (GRCm39) missense unknown
R8385:Spg11 UTSW 2 121,927,802 (GRCm39) missense probably benign 0.22
R8406:Spg11 UTSW 2 121,923,923 (GRCm39) missense probably damaging 0.99
R8480:Spg11 UTSW 2 121,943,560 (GRCm39) missense probably damaging 1.00
R8810:Spg11 UTSW 2 121,901,425 (GRCm39) missense probably damaging 0.98
R8883:Spg11 UTSW 2 121,943,561 (GRCm39) missense probably damaging 1.00
R8968:Spg11 UTSW 2 121,922,687 (GRCm39) missense probably damaging 0.99
R9008:Spg11 UTSW 2 121,900,413 (GRCm39) missense probably benign 0.05
R9059:Spg11 UTSW 2 121,918,788 (GRCm39) missense probably damaging 0.99
R9296:Spg11 UTSW 2 121,945,175 (GRCm39) missense probably benign 0.34
R9333:Spg11 UTSW 2 121,932,244 (GRCm39) missense probably damaging 0.99
R9657:Spg11 UTSW 2 121,910,781 (GRCm39) missense probably damaging 1.00
R9774:Spg11 UTSW 2 121,938,965 (GRCm39) missense probably damaging 0.99
Z1177:Spg11 UTSW 2 121,903,466 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCCACCGTATAGTTATCCTCTTC -3'
(R):5'- TGTGTCTCCTCAGCCAAGTG -3'

Sequencing Primer
(F):5'- TCATGACCCATGGTTGAGAAC -3'
(R):5'- GCCAAGTGCTGAAGGACACAC -3'
Posted On 2019-11-12