Mutagenetix > Incidental Mutation

Incidental Mutation 'R7665:Spg11'

591840

Institutional Source

Beutler Lab

Gene Symbol

Spg11

Ensembl Gene

ENSMUSG00000033396

Gene Name

SPG11, spatacsin vesicle trafficking associated

Synonyms

C530005A01Rik, 6030465E24Rik

MMRRC Submission

Accession Numbers

Genbank: NM_145531

Essential gene?

Probably non essential (E-score: 0.227) question?

Stock #

R7665 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122053520-122118386 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122066267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1686 (V1686E)

Ref Sequence

ENSEMBL: ENSMUSP00000037543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036450]

AlphaFold

Q3UHA3

Predicted Effect

probably damaging
Transcript: ENSMUST00000036450
AA Change: V1686E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: V1686E

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	254	276	N/A	INTRINSIC
low complexity region	945	958	N/A	INTRINSIC
low complexity region	1250	1264	N/A	INTRINSIC
low complexity region	1305	1313	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
low complexity region	1772	1784	N/A	INTRINSIC
Pfam:Spatacsin_C	2082	2374	1.1e-105	PFAM

Meta Mutation Damage Score

0.1862

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	A	G	5: 114,874,323		probably null	Het
A830018L16Rik	T	C	1: 11,972,099	S448P	probably damaging	Het
Abca4	C	T	3: 122,044,490		probably benign	Het
Ackr2	A	G	9: 121,909,308	M250V	probably benign	Het
Actn4	A	G	7: 28,916,207	I147T	probably damaging	Het
Adgrv1	C	T	13: 81,499,142	S3093N	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Brwd1	G	A	16: 96,041,343	T798M	probably benign	Het
Cdk13	G	A	13: 17,772,553	T540I	possibly damaging	Het
Cdkn1c	A	G	7: 143,460,634	V25A	possibly damaging	Het
Col2a1	T	C	15: 97,976,700	E1420G	unknown	Het
Dbf4	G	A	5: 8,397,867	P448S	probably damaging	Het
Dnajb7	T	C	15: 81,407,419	N239S	probably benign	Het
Dnttip1	A	G	2: 164,754,141	D102G	probably damaging	Het
Dpp8	T	A	9: 65,078,718	V830D	probably damaging	Het
Eef1g	T	C	19: 8,968,289	V29A	probably benign	Het
Enpp2	T	A	15: 54,839,394	Y906F	probably damaging	Het
Epb41l4a	A	G	18: 34,006,016	L23P	possibly damaging	Het
Epp13	G	A	7: 6,269,892		probably null	Het
Exoc1	T	A	5: 76,543,573	M248K	probably benign	Het
Fam83b	T	C	9: 76,490,875	Y982C	probably damaging	Het
Fat4	C	T	3: 38,889,178	A740V	probably benign	Het
Fsip2	T	A	2: 82,981,805	S2823T	probably benign	Het
Gckr	T	C	5: 31,297,555			Het
Gpr150	A	T	13: 76,055,974	V284E	probably damaging	Het
Grtp1	T	G	8: 13,177,103	I344L	probably benign	Het
Heatr5a	T	A	12: 51,961,530	N10I	probably damaging	Het
Herc2	C	A	7: 56,153,155	L2109I	probably damaging	Het
Hs1bp3	T	A	12: 8,317,935	D61E	probably damaging	Het
Ifit1bl1	T	A	19: 34,594,883	Y58F	probably benign	Het
Itfg1	A	G	8: 85,764,350	F317L	probably benign	Het
Itsn1	T	C	16: 91,841,603	I764T	unknown	Het
Med8	A	C	4: 118,411,656		probably null	Het
Mpeg1	C	A	19: 12,463,094	P639T	probably damaging	Het
Nedd9	A	G	13: 41,316,309	L456P	probably benign	Het
Neo1	A	G	9: 58,925,795	S556P	probably damaging	Het
Nphp3	T	A	9: 104,005,393		probably null	Het
Nup205	T	C	6: 35,177,620	V53A	possibly damaging	Het
Nvl	A	T	1: 181,134,944	S154T	probably benign	Het
Olfr239	G	T	17: 33,199,629	G194*	probably null	Het
Olfr391-ps	A	T	11: 73,798,961	N265K	probably benign	Het
Olfr615	A	T	7: 103,561,316	I280F	probably benign	Het
Olfr706	A	T	7: 106,886,673	V48D	possibly damaging	Het
Olfr827	T	A	10: 130,211,261		probably null	Het
Olfr92	A	G	17: 37,111,391	M197T	probably benign	Het
Parvg	T	C	15: 84,337,801	I243T	probably damaging	Het
Paxip1	T	A	5: 27,765,738	M538L	unknown	Het
Pgghg	G	T	7: 140,945,469	D428Y	probably damaging	Het
Pik3cd	C	T	4: 149,654,050	V777M	possibly damaging	Het
Plcl2	A	C	17: 50,607,157	K398T	probably benign	Het
Plxna1	A	T	6: 89,324,538		probably null	Het
Rbbp6	T	C	7: 122,994,686	Y514H	possibly damaging	Het
Rbbp6	T	A	7: 122,990,032		probably null	Het
Scin	T	A	12: 40,069,415	N538I	probably damaging	Het
Sdcbp	A	G	4: 6,385,144	D121G	probably benign	Het
Sgk1	T	C	10: 21,996,662	I311T	probably damaging	Het
Shq1	A	C	6: 100,573,756	L407W	probably damaging	Het
Sipa1	A	T	19: 5,651,671	S979T	probably benign	Het
Slc25a37	G	T	14: 69,249,579	T85K	probably benign	Het
Soga3	T	A	10: 29,196,397	Y562N	probably damaging	Het
Spag9	A	T	11: 94,013,654	Q112L	probably damaging	Het
Stap2	A	G	17: 55,997,909	V291A	probably benign	Het
Tnk2	C	T	16: 32,680,526	R886C	probably damaging	Het
Tnrc6c	T	A	11: 117,720,951	D138E	possibly damaging	Het
Unc13c	A	G	9: 73,680,474	S1426P	probably benign	Het
Vav1	G	A	17: 57,297,086	V163M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,988	K247*	probably null	Het
Zc2hc1c	T	C	12: 85,296,562	V491A	possibly damaging	Het
Zfp51	A	G	17: 21,463,581	T153A	probably benign	Het
Zyx	A	G	6: 42,356,162	E374G	probably damaging	Het

Other mutations in Spg11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Spg11	APN	2	122065560	missense	probably damaging	0.96
IGL00495:Spg11	APN	2	122094456	critical splice donor site	probably null
IGL00757:Spg11	APN	2	122070959	missense	probably benign	0.05
IGL01304:Spg11	APN	2	122072290	missense	probably damaging	1.00
IGL01355:Spg11	APN	2	122113156	missense	probably benign
IGL01626:Spg11	APN	2	122060971	missense	probably damaging	0.98
IGL01739:Spg11	APN	2	122114671	missense	probably damaging	1.00
IGL01835:Spg11	APN	2	122088224	missense	probably benign	0.36
IGL02129:Spg11	APN	2	122095686	missense	probably damaging	0.99
IGL02178:Spg11	APN	2	122097302	missense	probably damaging	1.00
IGL02199:Spg11	APN	2	122059553	missense	probably damaging	1.00
IGL02212:Spg11	APN	2	122108157	missense	probably benign	0.31
IGL02605:Spg11	APN	2	122092260	missense	probably benign	0.00
IGL02635:Spg11	APN	2	122113068	missense	possibly damaging	0.52
IGL02743:Spg11	APN	2	122059507	missense	probably damaging	0.97
IGL02822:Spg11	APN	2	122074534	missense	probably damaging	0.99
IGL02992:Spg11	APN	2	122058398	missense	probably damaging	1.00
IGL03010:Spg11	APN	2	122088320	missense	probably damaging	0.96
3-1:Spg11	UTSW	2	122086890	missense	probably damaging	0.98
PIT4354001:Spg11	UTSW	2	122088185	missense	probably damaging	0.98
R0131:Spg11	UTSW	2	122070968	missense	probably damaging	1.00
R0206:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0208:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0302:Spg11	UTSW	2	122092187	missense	possibly damaging	0.90
R0347:Spg11	UTSW	2	122097369	missense	probably damaging	0.99
R0357:Spg11	UTSW	2	122066232	splice site	probably benign
R0372:Spg11	UTSW	2	122059447	frame shift	probably null
R0715:Spg11	UTSW	2	122084983	missense	probably benign	0.03
R0927:Spg11	UTSW	2	122094487	missense	probably damaging	0.99
R1163:Spg11	UTSW	2	122070941	missense	probably damaging	1.00
R1534:Spg11	UTSW	2	122092325	missense	probably damaging	1.00
R1555:Spg11	UTSW	2	122097377	missense	probably damaging	0.99
R1569:Spg11	UTSW	2	122101706	missense	probably damaging	0.99
R1840:Spg11	UTSW	2	122101756	missense	probably damaging	1.00
R1929:Spg11	UTSW	2	122060207	missense	probably damaging	1.00
R2265:Spg11	UTSW	2	122108307	missense	possibly damaging	0.48
R2303:Spg11	UTSW	2	122068837	missense	probably damaging	0.99
R2510:Spg11	UTSW	2	122075310	missense	probably benign	0.03
R2760:Spg11	UTSW	2	122097359	missense	probably damaging	0.99
R2918:Spg11	UTSW	2	122075301	missense	probably damaging	0.99
R3195:Spg11	UTSW	2	122083398	critical splice donor site	probably null
R3423:Spg11	UTSW	2	122071053	missense	probably benign	0.00
R4353:Spg11	UTSW	2	122113194	missense	possibly damaging	0.92
R4407:Spg11	UTSW	2	122075332	missense	probably benign	0.00
R4644:Spg11	UTSW	2	122061029	missense	probably benign	0.03
R4663:Spg11	UTSW	2	122098099	critical splice donor site	probably null
R4684:Spg11	UTSW	2	122065076	missense	probably damaging	1.00
R4771:Spg11	UTSW	2	122065482	nonsense	probably null
R4810:Spg11	UTSW	2	122059796	missense	probably damaging	1.00
R4829:Spg11	UTSW	2	122108455	missense	probably benign	0.44
R5089:Spg11	UTSW	2	122114717	nonsense	probably null
R5362:Spg11	UTSW	2	122061000	missense	probably damaging	0.99
R5684:Spg11	UTSW	2	122093503	missense	probably damaging	1.00
R5899:Spg11	UTSW	2	122098199	missense	possibly damaging	0.67
R5923:Spg11	UTSW	2	122093478	missense	probably damaging	0.98
R6052:Spg11	UTSW	2	122097356	missense	probably damaging	0.99
R6111:Spg11	UTSW	2	122093482	missense	probably damaging	0.98
R6174:Spg11	UTSW	2	122086805	splice site	probably null
R6226:Spg11	UTSW	2	122088262	missense	possibly damaging	0.69
R6336:Spg11	UTSW	2	122112959	splice site	probably null
R6480:Spg11	UTSW	2	122092305	missense	probably benign	0.03
R6494:Spg11	UTSW	2	122113225	missense	probably damaging	0.98
R6582:Spg11	UTSW	2	122092292	missense	probably damaging	0.99
R6714:Spg11	UTSW	2	122095731	missense	probably damaging	0.99
R6791:Spg11	UTSW	2	122093443	missense	probably damaging	0.99
R6836:Spg11	UTSW	2	122059535	missense	probably damaging	1.00
R6928:Spg11	UTSW	2	122069904	missense	probably benign	0.37
R7179:Spg11	UTSW	2	122101789	splice site	probably null
R7229:Spg11	UTSW	2	122108104	missense	probably damaging	0.98
R7337:Spg11	UTSW	2	122084993	missense	probably benign	0.09
R7338:Spg11	UTSW	2	122055377	missense	probably damaging	1.00
R7351:Spg11	UTSW	2	122069931	missense	possibly damaging	0.95
R7378:Spg11	UTSW	2	122058429	missense	probably damaging	1.00
R7448:Spg11	UTSW	2	122093545	critical splice acceptor site	probably null
R7505:Spg11	UTSW	2	122075351	nonsense	probably null
R7685:Spg11	UTSW	2	122068880	missense	probably damaging	0.99
R7779:Spg11	UTSW	2	122070939	missense	probably damaging	1.00
R7947:Spg11	UTSW	2	122092322	missense	probably damaging	1.00
R7958:Spg11	UTSW	2	122092945	splice site	probably null
R8024:Spg11	UTSW	2	122097321	missense	possibly damaging	0.67
R8033:Spg11	UTSW	2	122086951	missense	probably damaging	1.00
R8069:Spg11	UTSW	2	122113156	missense	probably benign
R8121:Spg11	UTSW	2	122069867	critical splice donor site	probably null
R8252:Spg11	UTSW	2	122088339	splice site	probably benign
R8358:Spg11	UTSW	2	122080258	missense	possibly damaging	0.69
R8362:Spg11	UTSW	2	122118361	missense	unknown
R8385:Spg11	UTSW	2	122097321	missense	probably benign	0.22
R8406:Spg11	UTSW	2	122093442	missense	probably damaging	0.99
R8480:Spg11	UTSW	2	122113079	missense	probably damaging	1.00
R8810:Spg11	UTSW	2	122070944	missense	probably damaging	0.98
R8883:Spg11	UTSW	2	122113080	missense	probably damaging	1.00
R8968:Spg11	UTSW	2	122092206	missense	probably damaging	0.99
R9008:Spg11	UTSW	2	122069932	missense	probably benign	0.05
R9059:Spg11	UTSW	2	122088307	missense	probably damaging	0.99
R9296:Spg11	UTSW	2	122114694	missense	probably benign	0.34
R9333:Spg11	UTSW	2	122101763	missense	probably damaging	0.99
R9657:Spg11	UTSW	2	122080300	missense	probably damaging	1.00
R9774:Spg11	UTSW	2	122108484	missense	probably damaging	0.99
Z1177:Spg11	UTSW	2	122072985	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGCCACCGTATAGTTATCCTCTTC -3'
(R):5'- TGTGTCTCCTCAGCCAAGTG -3'

Sequencing Primer
(F):5'- TCATGACCCATGGTTGAGAAC -3'
(R):5'- GCCAAGTGCTGAAGGACACAC -3'

Posted On

2019-11-12