Incidental Mutation 'R7665:Abca4'
ID 591843
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene Name ATP-binding cassette, sub-family A (ABC1), member 4
Synonyms D430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission
Accession Numbers

Genbank: NM_007378; MGI: 109424
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7665 (G1)
Quality Score 186.009
Status Validated
Chromosome 3
Chromosomal Location 122044443-122180123 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 122044490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995]
AlphaFold O35600
Predicted Effect probably benign
Transcript: ENSMUST00000013995
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,874,323 probably null Het
A830018L16Rik T C 1: 11,972,099 S448P probably damaging Het
Ackr2 A G 9: 121,909,308 M250V probably benign Het
Actn4 A G 7: 28,916,207 I147T probably damaging Het
Adgrv1 C T 13: 81,499,142 S3093N probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Brwd1 G A 16: 96,041,343 T798M probably benign Het
Cdk13 G A 13: 17,772,553 T540I possibly damaging Het
Cdkn1c A G 7: 143,460,634 V25A possibly damaging Het
Col2a1 T C 15: 97,976,700 E1420G unknown Het
Dbf4 G A 5: 8,397,867 P448S probably damaging Het
Dnajb7 T C 15: 81,407,419 N239S probably benign Het
Dnttip1 A G 2: 164,754,141 D102G probably damaging Het
Dpp8 T A 9: 65,078,718 V830D probably damaging Het
Eef1g T C 19: 8,968,289 V29A probably benign Het
Enpp2 T A 15: 54,839,394 Y906F probably damaging Het
Epb41l4a A G 18: 34,006,016 L23P possibly damaging Het
Epp13 G A 7: 6,269,892 probably null Het
Exoc1 T A 5: 76,543,573 M248K probably benign Het
Fam83b T C 9: 76,490,875 Y982C probably damaging Het
Fat4 C T 3: 38,889,178 A740V probably benign Het
Fsip2 T A 2: 82,981,805 S2823T probably benign Het
Gckr T C 5: 31,297,555 Het
Gpr150 A T 13: 76,055,974 V284E probably damaging Het
Grtp1 T G 8: 13,177,103 I344L probably benign Het
Heatr5a T A 12: 51,961,530 N10I probably damaging Het
Herc2 C A 7: 56,153,155 L2109I probably damaging Het
Hs1bp3 T A 12: 8,317,935 D61E probably damaging Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Itfg1 A G 8: 85,764,350 F317L probably benign Het
Itsn1 T C 16: 91,841,603 I764T unknown Het
Med8 A C 4: 118,411,656 probably null Het
Mpeg1 C A 19: 12,463,094 P639T probably damaging Het
Nedd9 A G 13: 41,316,309 L456P probably benign Het
Neo1 A G 9: 58,925,795 S556P probably damaging Het
Nphp3 T A 9: 104,005,393 probably null Het
Nup205 T C 6: 35,177,620 V53A possibly damaging Het
Nvl A T 1: 181,134,944 S154T probably benign Het
Olfr239 G T 17: 33,199,629 G194* probably null Het
Olfr391-ps A T 11: 73,798,961 N265K probably benign Het
Olfr615 A T 7: 103,561,316 I280F probably benign Het
Olfr706 A T 7: 106,886,673 V48D possibly damaging Het
Olfr827 T A 10: 130,211,261 probably null Het
Olfr92 A G 17: 37,111,391 M197T probably benign Het
Parvg T C 15: 84,337,801 I243T probably damaging Het
Paxip1 T A 5: 27,765,738 M538L unknown Het
Pgghg G T 7: 140,945,469 D428Y probably damaging Het
Pik3cd C T 4: 149,654,050 V777M possibly damaging Het
Plcl2 A C 17: 50,607,157 K398T probably benign Het
Plxna1 A T 6: 89,324,538 probably null Het
Rbbp6 T C 7: 122,994,686 Y514H possibly damaging Het
Rbbp6 T A 7: 122,990,032 probably null Het
Scin T A 12: 40,069,415 N538I probably damaging Het
Sdcbp A G 4: 6,385,144 D121G probably benign Het
Sgk1 T C 10: 21,996,662 I311T probably damaging Het
Shq1 A C 6: 100,573,756 L407W probably damaging Het
Sipa1 A T 19: 5,651,671 S979T probably benign Het
Slc25a37 G T 14: 69,249,579 T85K probably benign Het
Soga3 T A 10: 29,196,397 Y562N probably damaging Het
Spag9 A T 11: 94,013,654 Q112L probably damaging Het
Spg11 A T 2: 122,066,267 V1686E probably damaging Het
Stap2 A G 17: 55,997,909 V291A probably benign Het
Tnk2 C T 16: 32,680,526 R886C probably damaging Het
Tnrc6c T A 11: 117,720,951 D138E possibly damaging Het
Unc13c A G 9: 73,680,474 S1426P probably benign Het
Vav1 G A 17: 57,297,086 V163M probably damaging Het
Vmn2r67 T A 7: 85,151,988 K247* probably null Het
Zc2hc1c T C 12: 85,296,562 V491A possibly damaging Het
Zfp51 A G 17: 21,463,581 T153A probably benign Het
Zyx A G 6: 42,356,162 E374G probably damaging Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 splice site probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 splice site probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7935:Abca4 UTSW 3 122110537 missense possibly damaging 0.85
R8237:Abca4 UTSW 3 122162303 missense probably benign 0.00
R8255:Abca4 UTSW 3 122155277 missense probably benign 0.00
R8294:Abca4 UTSW 3 122103568 missense possibly damaging 0.75
R8504:Abca4 UTSW 3 122129334 missense probably benign 0.01
R8536:Abca4 UTSW 3 122179745 missense probably benign 0.01
R8714:Abca4 UTSW 3 122148879 missense probably benign 0.19
R8771:Abca4 UTSW 3 122086671 missense probably damaging 0.97
R8835:Abca4 UTSW 3 122102784 missense probably benign 0.00
R8845:Abca4 UTSW 3 122137002 missense probably damaging 1.00
R8856:Abca4 UTSW 3 122112447 missense probably benign
R8933:Abca4 UTSW 3 122128137 missense probably damaging 1.00
R9052:Abca4 UTSW 3 122147259 missense possibly damaging 0.68
R9095:Abca4 UTSW 3 122173907 missense possibly damaging 0.52
R9221:Abca4 UTSW 3 122128179 missense probably damaging 1.00
R9262:Abca4 UTSW 3 122170990 missense probably damaging 1.00
R9301:Abca4 UTSW 3 122087479 missense probably benign 0.24
R9367:Abca4 UTSW 3 122044548 start codon destroyed probably null 0.99
R9408:Abca4 UTSW 3 122137625 missense probably benign
R9425:Abca4 UTSW 3 122132695 missense probably damaging 1.00
R9464:Abca4 UTSW 3 122120065 missense probably benign 0.08
R9483:Abca4 UTSW 3 122085626 missense
R9751:Abca4 UTSW 3 122087477 missense probably benign 0.00
Z1176:Abca4 UTSW 3 122103488 missense probably damaging 1.00
Z1176:Abca4 UTSW 3 122156443 missense probably damaging 1.00
Z1177:Abca4 UTSW 3 122147786 missense possibly damaging 0.79
Z1177:Abca4 UTSW 3 122173914 missense probably benign 0.21
Z1189:Abca4 UTSW 3 122083993 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCGCACTTGTGTATTTAGGGCC -3'
(R):5'- AGGTGGCCTCCGAACTAAAG -3'

Sequencing Primer
(F):5'- GGGCCTTTCTCCGTCTATAAAGAAAC -3'
(R):5'- AAGGACAAACTAGCTCTCTTCTTCG -3'
Posted On 2019-11-12