Incidental Mutation 'R7665:Pik3cd'
ID 591847
Institutional Source Beutler Lab
Gene Symbol Pik3cd
Ensembl Gene ENSMUSG00000039936
Gene Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms 2410099E07Rik, p110delta, 2610208K16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 149649168-149702571 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 149654050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 777 (V777M)
Ref Sequence ENSEMBL: ENSMUSP00000101315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000177654]
AlphaFold O35904
Predicted Effect possibly damaging
Transcript: ENSMUST00000038859
AA Change: V775M

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: V775M

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 776 1042 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105688
AA Change: V774M

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: V774M

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 775 1041 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105689
AA Change: V773M

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: V773M

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 684 1.35e-84 SMART
PI3Kc 774 1040 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105690
AA Change: V777M

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: V777M

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118704
AA Change: V776M

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: V776M

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 687 1.8e-80 SMART
PI3Kc 777 1043 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122059
AA Change: V770M

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: V770M

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 408 6.47e-23 SMART
PI3Ka 492 681 8.56e-87 SMART
PI3Kc 771 1037 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177654
AA Change: V777M

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: V777M

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,874,323 probably null Het
A830018L16Rik T C 1: 11,972,099 S448P probably damaging Het
Abca4 C T 3: 122,044,490 probably benign Het
Ackr2 A G 9: 121,909,308 M250V probably benign Het
Actn4 A G 7: 28,916,207 I147T probably damaging Het
Adgrv1 C T 13: 81,499,142 S3093N probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Brwd1 G A 16: 96,041,343 T798M probably benign Het
Cdk13 G A 13: 17,772,553 T540I possibly damaging Het
Cdkn1c A G 7: 143,460,634 V25A possibly damaging Het
Col2a1 T C 15: 97,976,700 E1420G unknown Het
Dbf4 G A 5: 8,397,867 P448S probably damaging Het
Dnajb7 T C 15: 81,407,419 N239S probably benign Het
Dnttip1 A G 2: 164,754,141 D102G probably damaging Het
Dpp8 T A 9: 65,078,718 V830D probably damaging Het
Eef1g T C 19: 8,968,289 V29A probably benign Het
Enpp2 T A 15: 54,839,394 Y906F probably damaging Het
Epb41l4a A G 18: 34,006,016 L23P possibly damaging Het
Epp13 G A 7: 6,269,892 probably null Het
Exoc1 T A 5: 76,543,573 M248K probably benign Het
Fam83b T C 9: 76,490,875 Y982C probably damaging Het
Fat4 C T 3: 38,889,178 A740V probably benign Het
Fsip2 T A 2: 82,981,805 S2823T probably benign Het
Gckr T C 5: 31,297,555 Het
Gpr150 A T 13: 76,055,974 V284E probably damaging Het
Grtp1 T G 8: 13,177,103 I344L probably benign Het
Heatr5a T A 12: 51,961,530 N10I probably damaging Het
Herc2 C A 7: 56,153,155 L2109I probably damaging Het
Hs1bp3 T A 12: 8,317,935 D61E probably damaging Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Itfg1 A G 8: 85,764,350 F317L probably benign Het
Itsn1 T C 16: 91,841,603 I764T unknown Het
Med8 A C 4: 118,411,656 probably null Het
Mpeg1 C A 19: 12,463,094 P639T probably damaging Het
Nedd9 A G 13: 41,316,309 L456P probably benign Het
Neo1 A G 9: 58,925,795 S556P probably damaging Het
Nphp3 T A 9: 104,005,393 probably null Het
Nup205 T C 6: 35,177,620 V53A possibly damaging Het
Nvl A T 1: 181,134,944 S154T probably benign Het
Olfr239 G T 17: 33,199,629 G194* probably null Het
Olfr391-ps A T 11: 73,798,961 N265K probably benign Het
Olfr615 A T 7: 103,561,316 I280F probably benign Het
Olfr706 A T 7: 106,886,673 V48D possibly damaging Het
Olfr827 T A 10: 130,211,261 probably null Het
Olfr92 A G 17: 37,111,391 M197T probably benign Het
Parvg T C 15: 84,337,801 I243T probably damaging Het
Paxip1 T A 5: 27,765,738 M538L unknown Het
Pgghg G T 7: 140,945,469 D428Y probably damaging Het
Plcl2 A C 17: 50,607,157 K398T probably benign Het
Plxna1 A T 6: 89,324,538 probably null Het
Rbbp6 T C 7: 122,994,686 Y514H possibly damaging Het
Rbbp6 T A 7: 122,990,032 probably null Het
Scin T A 12: 40,069,415 N538I probably damaging Het
Sdcbp A G 4: 6,385,144 D121G probably benign Het
Sgk1 T C 10: 21,996,662 I311T probably damaging Het
Shq1 A C 6: 100,573,756 L407W probably damaging Het
Sipa1 A T 19: 5,651,671 S979T probably benign Het
Slc25a37 G T 14: 69,249,579 T85K probably benign Het
Soga3 T A 10: 29,196,397 Y562N probably damaging Het
Spag9 A T 11: 94,013,654 Q112L probably damaging Het
Spg11 A T 2: 122,066,267 V1686E probably damaging Het
Stap2 A G 17: 55,997,909 V291A probably benign Het
Tnk2 C T 16: 32,680,526 R886C probably damaging Het
Tnrc6c T A 11: 117,720,951 D138E possibly damaging Het
Unc13c A G 9: 73,680,474 S1426P probably benign Het
Vav1 G A 17: 57,297,086 V163M probably damaging Het
Vmn2r67 T A 7: 85,151,988 K247* probably null Het
Zc2hc1c T C 12: 85,296,562 V491A possibly damaging Het
Zfp51 A G 17: 21,463,581 T153A probably benign Het
Zyx A G 6: 42,356,162 E374G probably damaging Het
Other mutations in Pik3cd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Pik3cd APN 4 149657460 missense probably damaging 1.00
IGL01536:Pik3cd APN 4 149652666 missense probably damaging 1.00
IGL01636:Pik3cd APN 4 149654315 missense possibly damaging 0.82
IGL02794:Pik3cd APN 4 149654571 missense probably benign
grand_tetons UTSW 4 149652699 missense probably damaging 1.00
Helena UTSW 4 149651820 missense probably damaging 1.00
stinger UTSW 4 149657319 missense probably damaging 1.00
F5770:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
R0003:Pik3cd UTSW 4 149656379 critical splice donor site probably null
R0309:Pik3cd UTSW 4 149663220 missense probably damaging 1.00
R1246:Pik3cd UTSW 4 149659800 missense probably damaging 1.00
R1259:Pik3cd UTSW 4 149650648 nonsense probably null
R1533:Pik3cd UTSW 4 149655196 missense probably damaging 1.00
R1756:Pik3cd UTSW 4 149658750 missense probably benign 0.02
R1796:Pik3cd UTSW 4 149654119 missense possibly damaging 0.83
R1887:Pik3cd UTSW 4 149652634 missense probably damaging 1.00
R1988:Pik3cd UTSW 4 149663203 missense probably damaging 1.00
R2089:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R2091:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R4997:Pik3cd UTSW 4 149658984 missense probably damaging 1.00
R5391:Pik3cd UTSW 4 149659131 missense probably damaging 0.98
R5603:Pik3cd UTSW 4 149658855 missense probably benign
R6282:Pik3cd UTSW 4 149659743 missense probably benign 0.00
R6453:Pik3cd UTSW 4 149652302 missense probably damaging 1.00
R7286:Pik3cd UTSW 4 149659714 missense probably benign 0.08
R7423:Pik3cd UTSW 4 149651763 critical splice donor site probably null
R7508:Pik3cd UTSW 4 149654583 missense possibly damaging 0.78
R7897:Pik3cd UTSW 4 149657269 missense probably benign 0.06
R8039:Pik3cd UTSW 4 149659866 missense possibly damaging 0.91
R8476:Pik3cd UTSW 4 149651820 missense probably damaging 1.00
R9015:Pik3cd UTSW 4 149655598 missense probably benign 0.06
R9252:Pik3cd UTSW 4 149655630 missense possibly damaging 0.88
V7580:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7581:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7582:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7583:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
X0023:Pik3cd UTSW 4 149660034 missense probably benign 0.04
Z1176:Pik3cd UTSW 4 149654847 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATCTGCAGAGTCAGCATGTCC -3'
(R):5'- ATATGTGCATGCGCCAGGAG -3'

Sequencing Primer
(F):5'- AGAGTCAGCATGTCCTGGCG -3'
(R):5'- ATGCGCCAGGAGACCTACATG -3'
Posted On 2019-11-12