Mutagenetix > Incidental Mutations

Incidental Mutation 'R7665:Pik3cd'

591847

Institutional Source

Beutler Lab

Gene Symbol

Pik3cd

Ensembl Gene

ENSMUSG00000039936

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta

Synonyms

2410099E07Rik, p110delta, 2610208K16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R7665 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149649168-149702571 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 149654050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 777 (V777M)

Ref Sequence

ENSEMBL: ENSMUSP00000101315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000177654]

AlphaFold

O35904

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038859
AA Change: V775M

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: V775M

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	685	8.56e-87	SMART
PI3Kc	776	1042	5.65e-128	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105688
AA Change: V774M

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: V774M

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	685	8.56e-87	SMART
PI3Kc	775	1041	5.65e-128	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105689
AA Change: V773M

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: V773M

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	684	1.35e-84	SMART
PI3Kc	774	1040	5.65e-128	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105690
AA Change: V777M

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: V777M

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	688	1.22e-82	SMART
PI3Kc	778	1044	5.65e-128	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118704
AA Change: V776M

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: V776M

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	687	1.8e-80	SMART
PI3Kc	777	1043	5.65e-128	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000122059
AA Change: V770M

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: V770M

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	408	6.47e-23	SMART
PI3Ka	492	681	8.56e-87	SMART
PI3Kc	771	1037	5.65e-128	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177654
AA Change: V777M

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: V777M

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	688	1.22e-82	SMART
PI3Kc	778	1044	5.65e-128	SMART

Meta Mutation Damage Score

0.0645

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	A	G	5: 114,874,323		probably null	Het
A830018L16Rik	T	C	1: 11,972,099	S448P	probably damaging	Het
Abca4	C	T	3: 122,044,490		probably benign	Het
Ackr2	A	G	9: 121,909,308	M250V	probably benign	Het
Actn4	A	G	7: 28,916,207	I147T	probably damaging	Het
Adgrv1	C	T	13: 81,499,142	S3093N	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Brwd1	G	A	16: 96,041,343	T798M	probably benign	Het
Cdk13	G	A	13: 17,772,553	T540I	possibly damaging	Het
Cdkn1c	A	G	7: 143,460,634	V25A	possibly damaging	Het
Col2a1	T	C	15: 97,976,700	E1420G	unknown	Het
Dbf4	G	A	5: 8,397,867	P448S	probably damaging	Het
Dnajb7	T	C	15: 81,407,419	N239S	probably benign	Het
Dnttip1	A	G	2: 164,754,141	D102G	probably damaging	Het
Dpp8	T	A	9: 65,078,718	V830D	probably damaging	Het
Eef1g	T	C	19: 8,968,289	V29A	probably benign	Het
Enpp2	T	A	15: 54,839,394	Y906F	probably damaging	Het
Epb41l4a	A	G	18: 34,006,016	L23P	possibly damaging	Het
Epp13	G	A	7: 6,269,892		probably null	Het
Exoc1	T	A	5: 76,543,573	M248K	probably benign	Het
Fam83b	T	C	9: 76,490,875	Y982C	probably damaging	Het
Fat4	C	T	3: 38,889,178	A740V	probably benign	Het
Fsip2	T	A	2: 82,981,805	S2823T	probably benign	Het
Gckr	T	C	5: 31,297,555			Het
Gpr150	A	T	13: 76,055,974	V284E	probably damaging	Het
Grtp1	T	G	8: 13,177,103	I344L	probably benign	Het
Heatr5a	T	A	12: 51,961,530	N10I	probably damaging	Het
Herc2	C	A	7: 56,153,155	L2109I	probably damaging	Het
Hs1bp3	T	A	12: 8,317,935	D61E	probably damaging	Het
Ifit1bl1	T	A	19: 34,594,883	Y58F	probably benign	Het
Itfg1	A	G	8: 85,764,350	F317L	probably benign	Het
Itsn1	T	C	16: 91,841,603	I764T	unknown	Het
Med8	A	C	4: 118,411,656		probably null	Het
Mpeg1	C	A	19: 12,463,094	P639T	probably damaging	Het
Nedd9	A	G	13: 41,316,309	L456P	probably benign	Het
Neo1	A	G	9: 58,925,795	S556P	probably damaging	Het
Nphp3	T	A	9: 104,005,393		probably null	Het
Nup205	T	C	6: 35,177,620	V53A	possibly damaging	Het
Nvl	A	T	1: 181,134,944	S154T	probably benign	Het
Olfr239	G	T	17: 33,199,629	G194*	probably null	Het
Olfr391-ps	A	T	11: 73,798,961	N265K	probably benign	Het
Olfr615	A	T	7: 103,561,316	I280F	probably benign	Het
Olfr706	A	T	7: 106,886,673	V48D	possibly damaging	Het
Olfr827	T	A	10: 130,211,261		probably null	Het
Olfr92	A	G	17: 37,111,391	M197T	probably benign	Het
Parvg	T	C	15: 84,337,801	I243T	probably damaging	Het
Paxip1	T	A	5: 27,765,738	M538L	unknown	Het
Pgghg	G	T	7: 140,945,469	D428Y	probably damaging	Het
Plcl2	A	C	17: 50,607,157	K398T	probably benign	Het
Plxna1	A	T	6: 89,324,538		probably null	Het
Rbbp6	T	C	7: 122,994,686	Y514H	possibly damaging	Het
Rbbp6	T	A	7: 122,990,032		probably null	Het
Scin	T	A	12: 40,069,415	N538I	probably damaging	Het
Sdcbp	A	G	4: 6,385,144	D121G	probably benign	Het
Sgk1	T	C	10: 21,996,662	I311T	probably damaging	Het
Shq1	A	C	6: 100,573,756	L407W	probably damaging	Het
Sipa1	A	T	19: 5,651,671	S979T	probably benign	Het
Slc25a37	G	T	14: 69,249,579	T85K	probably benign	Het
Soga3	T	A	10: 29,196,397	Y562N	probably damaging	Het
Spag9	A	T	11: 94,013,654	Q112L	probably damaging	Het
Spg11	A	T	2: 122,066,267	V1686E	probably damaging	Het
Stap2	A	G	17: 55,997,909	V291A	probably benign	Het
Tnk2	C	T	16: 32,680,526	R886C	probably damaging	Het
Tnrc6c	T	A	11: 117,720,951	D138E	possibly damaging	Het
Unc13c	A	G	9: 73,680,474	S1426P	probably benign	Het
Vav1	G	A	17: 57,297,086	V163M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,988	K247*	probably null	Het
Zc2hc1c	T	C	12: 85,296,562	V491A	possibly damaging	Het
Zfp51	A	G	17: 21,463,581	T153A	probably benign	Het
Zyx	A	G	6: 42,356,162	E374G	probably damaging	Het

Other mutations in Pik3cd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Pik3cd	APN	4	149657460	missense	probably damaging	1.00
IGL01536:Pik3cd	APN	4	149652666	missense	probably damaging	1.00
IGL01636:Pik3cd	APN	4	149654315	missense	possibly damaging	0.82
IGL02794:Pik3cd	APN	4	149654571	missense	probably benign
grand_tetons	UTSW	4	149652699	missense	probably damaging	1.00
Helena	UTSW	4	149651820	missense	probably damaging	1.00
stinger	UTSW	4	149657319	missense	probably damaging	1.00
F5770:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
R0003:Pik3cd	UTSW	4	149656379	critical splice donor site	probably null
R0309:Pik3cd	UTSW	4	149663220	missense	probably damaging	1.00
R1246:Pik3cd	UTSW	4	149659800	missense	probably damaging	1.00
R1259:Pik3cd	UTSW	4	149650648	nonsense	probably null
R1533:Pik3cd	UTSW	4	149655196	missense	probably damaging	1.00
R1756:Pik3cd	UTSW	4	149658750	missense	probably benign	0.02
R1796:Pik3cd	UTSW	4	149654119	missense	possibly damaging	0.83
R1887:Pik3cd	UTSW	4	149652634	missense	probably damaging	1.00
R1988:Pik3cd	UTSW	4	149663203	missense	probably damaging	1.00
R2089:Pik3cd	UTSW	4	149652699	missense	probably damaging	1.00
R2091:Pik3cd	UTSW	4	149652699	missense	probably damaging	1.00
R4997:Pik3cd	UTSW	4	149658984	missense	probably damaging	1.00
R5391:Pik3cd	UTSW	4	149659131	missense	probably damaging	0.98
R5603:Pik3cd	UTSW	4	149658855	missense	probably benign
R6282:Pik3cd	UTSW	4	149659743	missense	probably benign	0.00
R6453:Pik3cd	UTSW	4	149652302	missense	probably damaging	1.00
R7286:Pik3cd	UTSW	4	149659714	missense	probably benign	0.08
R7423:Pik3cd	UTSW	4	149651763	critical splice donor site	probably null
R7508:Pik3cd	UTSW	4	149654583	missense	possibly damaging	0.78
R7897:Pik3cd	UTSW	4	149657269	missense	probably benign	0.06
R8039:Pik3cd	UTSW	4	149659866	missense	possibly damaging	0.91
R8476:Pik3cd	UTSW	4	149651820	missense	probably damaging	1.00
R9015:Pik3cd	UTSW	4	149655598	missense	probably benign	0.06
R9252:Pik3cd	UTSW	4	149655630	missense	possibly damaging	0.88
V7580:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
V7581:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
V7582:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
V7583:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
X0023:Pik3cd	UTSW	4	149660034	missense	probably benign	0.04
Z1176:Pik3cd	UTSW	4	149654847	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CATCTGCAGAGTCAGCATGTCC -3'
(R):5'- ATATGTGCATGCGCCAGGAG -3'

Sequencing Primer
(F):5'- AGAGTCAGCATGTCCTGGCG -3'
(R):5'- ATGCGCCAGGAGACCTACATG -3'

Posted On

2019-11-12