Incidental Mutation 'R7665:Paxip1'
ID 591849
Institutional Source Beutler Lab
Gene Symbol Paxip1
Ensembl Gene ENSMUSG00000002221
Gene Name PAX interacting (with transcription-activation domain) protein 1
Synonyms D5Ertd149e, PTIP
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 27945078-27996689 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 27970736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 538 (M538L)
Ref Sequence ENSEMBL: ENSMUSP00000002291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002291]
AlphaFold Q6NZQ4
Predicted Effect unknown
Transcript: ENSMUST00000002291
AA Change: M538L
SMART Domains Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221
AA Change: M538L

DomainStartEndE-ValueType
BRCT 10 83 6.72e1 SMART
BRCT 96 173 8.83e-15 SMART
low complexity region 189 208 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
coiled coil region 489 547 N/A INTRINSIC
BRCT 590 671 5.74e-14 SMART
BRCT 690 766 1.67e-15 SMART
BRCT 845 924 4.03e-9 SMART
BRCT 957 1046 3.54e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Paxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Paxip1 APN 5 27,977,550 (GRCm39) utr 3 prime probably benign
IGL01705:Paxip1 APN 5 27,953,857 (GRCm39) missense probably damaging 1.00
IGL01844:Paxip1 APN 5 27,956,036 (GRCm39) missense probably benign 0.17
IGL02143:Paxip1 APN 5 27,980,596 (GRCm39) utr 3 prime probably benign
IGL02863:Paxip1 APN 5 27,964,393 (GRCm39) missense probably benign 0.30
IGL02903:Paxip1 APN 5 27,953,870 (GRCm39) missense probably damaging 1.00
IGL03008:Paxip1 APN 5 27,957,764 (GRCm39) missense probably benign 0.01
BB003:Paxip1 UTSW 5 27,996,207 (GRCm39) missense unknown
BB013:Paxip1 UTSW 5 27,996,207 (GRCm39) missense unknown
R0128:Paxip1 UTSW 5 27,949,183 (GRCm39) splice site probably benign
R0130:Paxip1 UTSW 5 27,949,183 (GRCm39) splice site probably benign
R0331:Paxip1 UTSW 5 27,970,230 (GRCm39) missense probably damaging 0.96
R0357:Paxip1 UTSW 5 27,963,621 (GRCm39) splice site probably benign
R0370:Paxip1 UTSW 5 27,965,084 (GRCm39) missense probably damaging 1.00
R0625:Paxip1 UTSW 5 27,970,940 (GRCm39) nonsense probably null
R1969:Paxip1 UTSW 5 27,949,134 (GRCm39) missense probably damaging 1.00
R2214:Paxip1 UTSW 5 27,947,499 (GRCm39) missense probably damaging 1.00
R3424:Paxip1 UTSW 5 27,980,671 (GRCm39) utr 3 prime probably benign
R3808:Paxip1 UTSW 5 27,977,027 (GRCm39) unclassified probably benign
R3809:Paxip1 UTSW 5 27,977,027 (GRCm39) unclassified probably benign
R3881:Paxip1 UTSW 5 27,953,837 (GRCm39) missense probably damaging 1.00
R3882:Paxip1 UTSW 5 27,953,837 (GRCm39) missense probably damaging 1.00
R4685:Paxip1 UTSW 5 27,966,675 (GRCm39) splice site probably null
R4692:Paxip1 UTSW 5 27,977,095 (GRCm39) unclassified probably benign
R4776:Paxip1 UTSW 5 27,970,204 (GRCm39) missense probably damaging 1.00
R5093:Paxip1 UTSW 5 27,971,282 (GRCm39) missense unknown
R5388:Paxip1 UTSW 5 27,986,453 (GRCm39) utr 3 prime probably benign
R5397:Paxip1 UTSW 5 27,977,002 (GRCm39) unclassified probably benign
R5553:Paxip1 UTSW 5 27,980,637 (GRCm39) utr 3 prime probably benign
R6151:Paxip1 UTSW 5 27,966,616 (GRCm39) missense probably damaging 1.00
R6216:Paxip1 UTSW 5 27,971,171 (GRCm39) missense unknown
R6276:Paxip1 UTSW 5 27,966,666 (GRCm39) missense probably damaging 1.00
R6290:Paxip1 UTSW 5 27,970,576 (GRCm39) splice site probably null
R6584:Paxip1 UTSW 5 27,963,450 (GRCm39) missense probably damaging 0.98
R6688:Paxip1 UTSW 5 27,949,135 (GRCm39) missense probably benign 0.18
R6908:Paxip1 UTSW 5 27,996,222 (GRCm39) missense possibly damaging 0.90
R6981:Paxip1 UTSW 5 27,970,766 (GRCm39) nonsense probably null
R7252:Paxip1 UTSW 5 27,965,084 (GRCm39) missense probably damaging 0.96
R7385:Paxip1 UTSW 5 27,986,418 (GRCm39) critical splice donor site probably null
R7585:Paxip1 UTSW 5 27,977,002 (GRCm39) missense unknown
R7926:Paxip1 UTSW 5 27,996,207 (GRCm39) missense unknown
R8169:Paxip1 UTSW 5 27,977,093 (GRCm39) missense unknown
R8335:Paxip1 UTSW 5 27,971,122 (GRCm39) missense unknown
R8732:Paxip1 UTSW 5 27,949,541 (GRCm39) missense probably damaging 1.00
R8790:Paxip1 UTSW 5 27,977,078 (GRCm39) missense unknown
X0066:Paxip1 UTSW 5 27,971,016 (GRCm39) missense unknown
Z1176:Paxip1 UTSW 5 27,988,727 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTGATAGGCGCCATGCTC -3'
(R):5'- ATCGTCCTCAACAGCAGCTG -3'

Sequencing Primer
(F):5'- ACGCAAGCTTGTAACTTGTGAG -3'
(R):5'- AGCAGCTGCAGCCATTTCAG -3'
Posted On 2019-11-12