Mutagenetix > Incidental Mutation

Incidental Mutation 'R7665:Exoc1'

591851

Institutional Source

Beutler Lab

Gene Symbol

Exoc1

Ensembl Gene

ENSMUSG00000036435

Gene Name

exocyst complex component 1

Synonyms

2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7665 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76529311-76570294 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76543573 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 248 (M248K)

Ref Sequence

ENSEMBL: ENSMUSP00000109121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493]

AlphaFold

Q8R3S6

Predicted Effect

probably benign
Transcript: ENSMUST00000049469
AA Change: M241K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435
AA Change: M241K

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
Pfam:Sec3_C	169	856	5.5e-221	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000087133
AA Change: M241K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435
AA Change: M241K

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
Pfam:Sec3_C	169	871	2e-220	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113493
AA Change: M248K

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435
AA Change: M248K

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
coiled coil region	161	183	N/A	INTRINSIC
Pfam:Sec3_C	190	878	4.1e-186	PFAM

Meta Mutation Damage Score

0.1401

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	A	G	5: 114,874,323		probably null	Het
A830018L16Rik	T	C	1: 11,972,099	S448P	probably damaging	Het
Abca4	C	T	3: 122,044,490		probably benign	Het
Ackr2	A	G	9: 121,909,308	M250V	probably benign	Het
Actn4	A	G	7: 28,916,207	I147T	probably damaging	Het
Adgrv1	C	T	13: 81,499,142	S3093N	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Brwd1	G	A	16: 96,041,343	T798M	probably benign	Het
Cdk13	G	A	13: 17,772,553	T540I	possibly damaging	Het
Cdkn1c	A	G	7: 143,460,634	V25A	possibly damaging	Het
Col2a1	T	C	15: 97,976,700	E1420G	unknown	Het
Dbf4	G	A	5: 8,397,867	P448S	probably damaging	Het
Dnajb7	T	C	15: 81,407,419	N239S	probably benign	Het
Dnttip1	A	G	2: 164,754,141	D102G	probably damaging	Het
Dpp8	T	A	9: 65,078,718	V830D	probably damaging	Het
Eef1g	T	C	19: 8,968,289	V29A	probably benign	Het
Enpp2	T	A	15: 54,839,394	Y906F	probably damaging	Het
Epb41l4a	A	G	18: 34,006,016	L23P	possibly damaging	Het
Epp13	G	A	7: 6,269,892		probably null	Het
Fam83b	T	C	9: 76,490,875	Y982C	probably damaging	Het
Fat4	C	T	3: 38,889,178	A740V	probably benign	Het
Fsip2	T	A	2: 82,981,805	S2823T	probably benign	Het
Gckr	T	C	5: 31,297,555			Het
Gpr150	A	T	13: 76,055,974	V284E	probably damaging	Het
Grtp1	T	G	8: 13,177,103	I344L	probably benign	Het
Heatr5a	T	A	12: 51,961,530	N10I	probably damaging	Het
Herc2	C	A	7: 56,153,155	L2109I	probably damaging	Het
Hs1bp3	T	A	12: 8,317,935	D61E	probably damaging	Het
Ifit1bl1	T	A	19: 34,594,883	Y58F	probably benign	Het
Itfg1	A	G	8: 85,764,350	F317L	probably benign	Het
Itsn1	T	C	16: 91,841,603	I764T	unknown	Het
Med8	A	C	4: 118,411,656		probably null	Het
Mpeg1	C	A	19: 12,463,094	P639T	probably damaging	Het
Nedd9	A	G	13: 41,316,309	L456P	probably benign	Het
Neo1	A	G	9: 58,925,795	S556P	probably damaging	Het
Nphp3	T	A	9: 104,005,393		probably null	Het
Nup205	T	C	6: 35,177,620	V53A	possibly damaging	Het
Nvl	A	T	1: 181,134,944	S154T	probably benign	Het
Olfr239	G	T	17: 33,199,629	G194*	probably null	Het
Olfr391-ps	A	T	11: 73,798,961	N265K	probably benign	Het
Olfr615	A	T	7: 103,561,316	I280F	probably benign	Het
Olfr706	A	T	7: 106,886,673	V48D	possibly damaging	Het
Olfr827	T	A	10: 130,211,261		probably null	Het
Olfr92	A	G	17: 37,111,391	M197T	probably benign	Het
Parvg	T	C	15: 84,337,801	I243T	probably damaging	Het
Paxip1	T	A	5: 27,765,738	M538L	unknown	Het
Pgghg	G	T	7: 140,945,469	D428Y	probably damaging	Het
Pik3cd	C	T	4: 149,654,050	V777M	possibly damaging	Het
Plcl2	A	C	17: 50,607,157	K398T	probably benign	Het
Plxna1	A	T	6: 89,324,538		probably null	Het
Rbbp6	T	C	7: 122,994,686	Y514H	possibly damaging	Het
Rbbp6	T	A	7: 122,990,032		probably null	Het
Scin	T	A	12: 40,069,415	N538I	probably damaging	Het
Sdcbp	A	G	4: 6,385,144	D121G	probably benign	Het
Sgk1	T	C	10: 21,996,662	I311T	probably damaging	Het
Shq1	A	C	6: 100,573,756	L407W	probably damaging	Het
Sipa1	A	T	19: 5,651,671	S979T	probably benign	Het
Slc25a37	G	T	14: 69,249,579	T85K	probably benign	Het
Soga3	T	A	10: 29,196,397	Y562N	probably damaging	Het
Spag9	A	T	11: 94,013,654	Q112L	probably damaging	Het
Spg11	A	T	2: 122,066,267	V1686E	probably damaging	Het
Stap2	A	G	17: 55,997,909	V291A	probably benign	Het
Tnk2	C	T	16: 32,680,526	R886C	probably damaging	Het
Tnrc6c	T	A	11: 117,720,951	D138E	possibly damaging	Het
Unc13c	A	G	9: 73,680,474	S1426P	probably benign	Het
Vav1	G	A	17: 57,297,086	V163M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,988	K247*	probably null	Het
Zc2hc1c	T	C	12: 85,296,562	V491A	possibly damaging	Het
Zfp51	A	G	17: 21,463,581	T153A	probably benign	Het
Zyx	A	G	6: 42,356,162	E374G	probably damaging	Het

Other mutations in Exoc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00679:Exoc1	APN	5	76567023	missense	possibly damaging	0.88
IGL01149:Exoc1	APN	5	76542244	splice site	probably benign
IGL02061:Exoc1	APN	5	76542120	missense	probably damaging	0.96
IGL02288:Exoc1	APN	5	76545313	missense	probably benign
IGL02407:Exoc1	APN	5	76545346	missense	probably damaging	0.97
IGL03089:Exoc1	APN	5	76542158	missense	possibly damaging	0.81
IGL03242:Exoc1	APN	5	76559007	missense	probably damaging	1.00
IGL03348:Exoc1	APN	5	76535593	missense	probably damaging	1.00
IGL03411:Exoc1	APN	5	76542195	missense	probably damaging	1.00
Smalls	UTSW	5	76537779	missense	probably damaging	1.00
R0462:Exoc1	UTSW	5	76543617	missense	probably benign	0.37
R1216:Exoc1	UTSW	5	76554188	missense	probably benign
R1528:Exoc1	UTSW	5	76549564	missense	possibly damaging	0.94
R1531:Exoc1	UTSW	5	76559164	missense	probably damaging	0.98
R1636:Exoc1	UTSW	5	76568118	missense	probably benign	0.03
R1754:Exoc1	UTSW	5	76560322	splice site	probably null
R1803:Exoc1	UTSW	5	76561441	missense	probably benign	0.18
R2086:Exoc1	UTSW	5	76532846	nonsense	probably null
R2239:Exoc1	UTSW	5	76559710	unclassified	probably benign
R3914:Exoc1	UTSW	5	76543561	missense	possibly damaging	0.54
R4022:Exoc1	UTSW	5	76549570	missense	possibly damaging	0.92
R4329:Exoc1	UTSW	5	76567975	missense	probably damaging	1.00
R4413:Exoc1	UTSW	5	76542019	intron	probably benign
R4427:Exoc1	UTSW	5	76563263	missense	probably benign	0.00
R4557:Exoc1	UTSW	5	76561443	missense	probably damaging	1.00
R4627:Exoc1	UTSW	5	76542228	missense	probably benign	0.26
R4677:Exoc1	UTSW	5	76559163	missense	probably null	0.82
R5138:Exoc1	UTSW	5	76568075	missense	probably damaging	1.00
R5325:Exoc1	UTSW	5	76537702	missense	probably benign
R5342:Exoc1	UTSW	5	76567014	missense	probably damaging	1.00
R5736:Exoc1	UTSW	5	76537768	missense	possibly damaging	0.90
R5891:Exoc1	UTSW	5	76542144	missense	probably damaging	1.00
R6102:Exoc1	UTSW	5	76537779	missense	probably damaging	1.00
R6447:Exoc1	UTSW	5	76543517	missense	probably damaging	0.97
R6532:Exoc1	UTSW	5	76537837	missense	probably damaging	0.99
R6694:Exoc1	UTSW	5	76549552	missense	probably damaging	1.00
R6753:Exoc1	UTSW	5	76563339	missense	probably damaging	1.00
R6885:Exoc1	UTSW	5	76559042	missense	probably damaging	1.00
R7090:Exoc1	UTSW	5	76566953	missense	unknown
R7299:Exoc1	UTSW	5	76542159	missense	probably damaging	1.00
R7439:Exoc1	UTSW	5	76545348	missense	probably benign	0.18
R7567:Exoc1	UTSW	5	76537715	missense	probably damaging	0.96
R7745:Exoc1	UTSW	5	76561512	nonsense	probably null
R7883:Exoc1	UTSW	5	76561382	missense	probably damaging	0.99
R7918:Exoc1	UTSW	5	76543993	missense	probably benign	0.10
R7956:Exoc1	UTSW	5	76557857	missense	probably benign	0.01
R7977:Exoc1	UTSW	5	76543585	missense	probably damaging	1.00
R7987:Exoc1	UTSW	5	76543585	missense	probably damaging	1.00
R8191:Exoc1	UTSW	5	76559827	critical splice donor site	probably null
R8286:Exoc1	UTSW	5	76563240	missense	probably benign	0.00
R8670:Exoc1	UTSW	5	76569658	missense	probably damaging	1.00
R8791:Exoc1	UTSW	5	76535565	missense	probably damaging	1.00
R9308:Exoc1	UTSW	5	76559121	missense	probably benign	0.10
R9410:Exoc1	UTSW	5	76559142	missense	probably benign	0.21
R9717:Exoc1	UTSW	5	76563232	missense	probably benign	0.22
X0018:Exoc1	UTSW	5	76567035	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGACTTGACGCAGAGAGCTC -3'
(R):5'- CACAAGGAAGCTGGTTTGTAAGTG -3'

Sequencing Primer
(F):5'- TGGCAGCGTCTCACCTCTG -3'
(R):5'- GTGAGTTTTACATAACATCACTAGGC -3'

Posted On

2019-11-12