Mutagenetix > Incidental Mutation

Incidental Mutation 'R7665:Plxna1'

591854

Institutional Source

Beutler Lab

Gene Symbol

Plxna1

Ensembl Gene

ENSMUSG00000030084

Gene Name

plexin A1

Synonyms

NOV, Plxn1, PlexA1, 2600013D04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.848) question?

Stock #

R7665 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89316314-89362620 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 89324538 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000063066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]

AlphaFold

P70206

PDB Structure

The Plexin A1 intracellular region in complex with Rac1 [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000049845

SMART Domains

Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1316	1864	8.8e-263	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000163139

SMART Domains

Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1315	1864	2.5e-264	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204468

Meta Mutation Damage Score

0.9497

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	A	G	5: 114,874,323		probably null	Het
A830018L16Rik	T	C	1: 11,972,099	S448P	probably damaging	Het
Abca4	C	T	3: 122,044,490		probably benign	Het
Ackr2	A	G	9: 121,909,308	M250V	probably benign	Het
Actn4	A	G	7: 28,916,207	I147T	probably damaging	Het
Adgrv1	C	T	13: 81,499,142	S3093N	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Brwd1	G	A	16: 96,041,343	T798M	probably benign	Het
Cdk13	G	A	13: 17,772,553	T540I	possibly damaging	Het
Cdkn1c	A	G	7: 143,460,634	V25A	possibly damaging	Het
Col2a1	T	C	15: 97,976,700	E1420G	unknown	Het
Dbf4	G	A	5: 8,397,867	P448S	probably damaging	Het
Dnajb7	T	C	15: 81,407,419	N239S	probably benign	Het
Dnttip1	A	G	2: 164,754,141	D102G	probably damaging	Het
Dpp8	T	A	9: 65,078,718	V830D	probably damaging	Het
Eef1g	T	C	19: 8,968,289	V29A	probably benign	Het
Enpp2	T	A	15: 54,839,394	Y906F	probably damaging	Het
Epb41l4a	A	G	18: 34,006,016	L23P	possibly damaging	Het
Epp13	G	A	7: 6,269,892		probably null	Het
Exoc1	T	A	5: 76,543,573	M248K	probably benign	Het
Fam83b	T	C	9: 76,490,875	Y982C	probably damaging	Het
Fat4	C	T	3: 38,889,178	A740V	probably benign	Het
Fsip2	T	A	2: 82,981,805	S2823T	probably benign	Het
Gckr	T	C	5: 31,297,555			Het
Gpr150	A	T	13: 76,055,974	V284E	probably damaging	Het
Grtp1	T	G	8: 13,177,103	I344L	probably benign	Het
Heatr5a	T	A	12: 51,961,530	N10I	probably damaging	Het
Herc2	C	A	7: 56,153,155	L2109I	probably damaging	Het
Hs1bp3	T	A	12: 8,317,935	D61E	probably damaging	Het
Ifit1bl1	T	A	19: 34,594,883	Y58F	probably benign	Het
Itfg1	A	G	8: 85,764,350	F317L	probably benign	Het
Itsn1	T	C	16: 91,841,603	I764T	unknown	Het
Med8	A	C	4: 118,411,656		probably null	Het
Mpeg1	C	A	19: 12,463,094	P639T	probably damaging	Het
Nedd9	A	G	13: 41,316,309	L456P	probably benign	Het
Neo1	A	G	9: 58,925,795	S556P	probably damaging	Het
Nphp3	T	A	9: 104,005,393		probably null	Het
Nup205	T	C	6: 35,177,620	V53A	possibly damaging	Het
Nvl	A	T	1: 181,134,944	S154T	probably benign	Het
Olfr239	G	T	17: 33,199,629	G194*	probably null	Het
Olfr391-ps	A	T	11: 73,798,961	N265K	probably benign	Het
Olfr615	A	T	7: 103,561,316	I280F	probably benign	Het
Olfr706	A	T	7: 106,886,673	V48D	possibly damaging	Het
Olfr827	T	A	10: 130,211,261		probably null	Het
Olfr92	A	G	17: 37,111,391	M197T	probably benign	Het
Parvg	T	C	15: 84,337,801	I243T	probably damaging	Het
Paxip1	T	A	5: 27,765,738	M538L	unknown	Het
Pgghg	G	T	7: 140,945,469	D428Y	probably damaging	Het
Pik3cd	C	T	4: 149,654,050	V777M	possibly damaging	Het
Plcl2	A	C	17: 50,607,157	K398T	probably benign	Het
Rbbp6	T	A	7: 122,990,032		probably null	Het
Rbbp6	T	C	7: 122,994,686	Y514H	possibly damaging	Het
Scin	T	A	12: 40,069,415	N538I	probably damaging	Het
Sdcbp	A	G	4: 6,385,144	D121G	probably benign	Het
Sgk1	T	C	10: 21,996,662	I311T	probably damaging	Het
Shq1	A	C	6: 100,573,756	L407W	probably damaging	Het
Sipa1	A	T	19: 5,651,671	S979T	probably benign	Het
Slc25a37	G	T	14: 69,249,579	T85K	probably benign	Het
Soga3	T	A	10: 29,196,397	Y562N	probably damaging	Het
Spag9	A	T	11: 94,013,654	Q112L	probably damaging	Het
Spg11	A	T	2: 122,066,267	V1686E	probably damaging	Het
Stap2	A	G	17: 55,997,909	V291A	probably benign	Het
Tnk2	C	T	16: 32,680,526	R886C	probably damaging	Het
Tnrc6c	T	A	11: 117,720,951	D138E	possibly damaging	Het
Unc13c	A	G	9: 73,680,474	S1426P	probably benign	Het
Vav1	G	A	17: 57,297,086	V163M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,988	K247*	probably null	Het
Zc2hc1c	T	C	12: 85,296,562	V491A	possibly damaging	Het
Zfp51	A	G	17: 21,463,581	T153A	probably benign	Het
Zyx	A	G	6: 42,356,162	E374G	probably damaging	Het

Other mutations in Plxna1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Plxna1	APN	6	89320998	missense	probably damaging	1.00
IGL01358:Plxna1	APN	6	89322750	missense	probably damaging	1.00
IGL01475:Plxna1	APN	6	89354888	missense	possibly damaging	0.92
IGL01480:Plxna1	APN	6	89344096	missense	possibly damaging	0.70
IGL01585:Plxna1	APN	6	89329556	critical splice donor site	probably null
IGL01804:Plxna1	APN	6	89329646	missense	probably damaging	1.00
IGL01909:Plxna1	APN	6	89332084	critical splice donor site	probably null
IGL01989:Plxna1	APN	6	89329414	nonsense	probably null
IGL02015:Plxna1	APN	6	89342451	missense	probably damaging	1.00
IGL02023:Plxna1	APN	6	89357332	missense	possibly damaging	0.88
IGL02668:Plxna1	APN	6	89357269	nonsense	probably null
IGL02703:Plxna1	APN	6	89356943	missense	probably damaging	1.00
IGL02954:Plxna1	APN	6	89324667	missense	probably damaging	1.00
IGL03212:Plxna1	APN	6	89331903	missense	probably damaging	1.00
PIT4544001:Plxna1	UTSW	6	89357429	missense	probably benign	0.14
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0147:Plxna1	UTSW	6	89320710	missense	possibly damaging	0.95
R0149:Plxna1	UTSW	6	89320613	missense	probably null	0.95
R0166:Plxna1	UTSW	6	89333019	missense	probably damaging	1.00
R0200:Plxna1	UTSW	6	89323593	missense	probably damaging	1.00
R0415:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
R0841:Plxna1	UTSW	6	89332204	missense	probably damaging	1.00
R1018:Plxna1	UTSW	6	89342960	missense	probably damaging	1.00
R1240:Plxna1	UTSW	6	89321050	missense	probably damaging	1.00
R1355:Plxna1	UTSW	6	89320766	unclassified	probably benign
R1700:Plxna1	UTSW	6	89357008	missense	probably damaging	1.00
R1776:Plxna1	UTSW	6	89335464	missense	probably benign	0.00
R1957:Plxna1	UTSW	6	89331291	missense	probably damaging	1.00
R2314:Plxna1	UTSW	6	89324316	missense	probably damaging	1.00
R2968:Plxna1	UTSW	6	89342608	missense	probably damaging	1.00
R3118:Plxna1	UTSW	6	89356976	missense	possibly damaging	0.89
R3522:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R3619:Plxna1	UTSW	6	89357453	missense	probably damaging	0.97
R3766:Plxna1	UTSW	6	89334775	unclassified	probably benign
R3847:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3849:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3872:Plxna1	UTSW	6	89332692	nonsense	probably null
R4555:Plxna1	UTSW	6	89323328	missense	probably damaging	0.99
R4709:Plxna1	UTSW	6	89334751	missense	possibly damaging	0.72
R4726:Plxna1	UTSW	6	89322816	missense	probably damaging	1.00
R4739:Plxna1	UTSW	6	89332675	splice site	probably null
R5053:Plxna1	UTSW	6	89322460	missense	probably damaging	1.00
R5221:Plxna1	UTSW	6	89321016	missense	probably damaging	1.00
R5449:Plxna1	UTSW	6	89323608	missense	probably damaging	1.00
R5480:Plxna1	UTSW	6	89324634	missense	probably damaging	1.00
R5575:Plxna1	UTSW	6	89324541	missense	possibly damaging	0.83
R5743:Plxna1	UTSW	6	89356529	missense	probably damaging	1.00
R5744:Plxna1	UTSW	6	89334682	missense	possibly damaging	0.67
R5754:Plxna1	UTSW	6	89333105	missense	possibly damaging	0.96
R5868:Plxna1	UTSW	6	89322722	splice site	probably benign
R5988:Plxna1	UTSW	6	89357540	nonsense	probably null
R6190:Plxna1	UTSW	6	89356604	nonsense	probably null
R6425:Plxna1	UTSW	6	89334665	missense	probably benign	0.00
R6561:Plxna1	UTSW	6	89356978	missense	probably damaging	1.00
R6623:Plxna1	UTSW	6	89322771	missense	probably damaging	1.00
R6638:Plxna1	UTSW	6	89324400	missense	probably damaging	0.97
R6701:Plxna1	UTSW	6	89319448	missense	probably damaging	0.99
R6825:Plxna1	UTSW	6	89320615	missense	probably benign	0.01
R6911:Plxna1	UTSW	6	89320974	missense	probably damaging	1.00
R7073:Plxna1	UTSW	6	89357329	missense	probably damaging	1.00
R7177:Plxna1	UTSW	6	89323329	missense	possibly damaging	0.50
R7235:Plxna1	UTSW	6	89340591	missense	probably damaging	0.97
R7419:Plxna1	UTSW	6	89357602	missense	unknown
R7511:Plxna1	UTSW	6	89341907	missense	possibly damaging	0.71
R7543:Plxna1	UTSW	6	89322855	missense	probably damaging	1.00
R7678:Plxna1	UTSW	6	89331900	missense	probably damaging	0.99
R7748:Plxna1	UTSW	6	89337352	critical splice acceptor site	probably null
R7748:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R7877:Plxna1	UTSW	6	89323259	missense	probably damaging	0.99
R8025:Plxna1	UTSW	6	89331272	missense	probably damaging	1.00
R8171:Plxna1	UTSW	6	89357120	missense	probably benign	0.20
R8277:Plxna1	UTSW	6	89357180	missense	probably damaging	1.00
R8782:Plxna1	UTSW	6	89323238	missense	probably damaging	1.00
R8867:Plxna1	UTSW	6	89333097	missense	probably benign	0.00
R9245:Plxna1	UTSW	6	89337338	missense	probably damaging	1.00
R9253:Plxna1	UTSW	6	89357540	nonsense	probably null
R9269:Plxna1	UTSW	6	89329559	missense	probably null	1.00
R9273:Plxna1	UTSW	6	89319382	missense	possibly damaging	0.77
R9281:Plxna1	UTSW	6	89323331	missense	probably damaging	1.00
R9368:Plxna1	UTSW	6	89337156	missense	probably benign
R9440:Plxna1	UTSW	6	89341930	missense	probably benign	0.00
R9526:Plxna1	UTSW	6	89342651	missense	probably benign
R9601:Plxna1	UTSW	6	89331271	missense	probably damaging	1.00
R9714:Plxna1	UTSW	6	89319458	missense	probably damaging	0.99
R9782:Plxna1	UTSW	6	89356835	missense	probably benign	0.01
S24628:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
V8831:Plxna1	UTSW	6	89357137	missense	probably damaging	0.99
Z1176:Plxna1	UTSW	6	89321052	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCACGGTGTCACAGTTCAG -3'
(R):5'- CTTAAAGGGCTGACAGGTCC -3'

Sequencing Primer
(F):5'- AGTTCAGCCCCTTCACAGG -3'
(R):5'- TTAAAGGGCTGACAGGTCCAATCC -3'

Posted On

2019-11-12