Incidental Mutation 'R7665:Plxna1'
ID 591854
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Name plexin A1
Synonyms NOV, PlexA1, Plxn1, 2600013D04Rik
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.888) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 89293295-89339595 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 89301520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
AlphaFold P70206
PDB Structure The Plexin A1 intracellular region in complex with Rac1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000049845
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163139
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204468
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89,297,980 (GRCm39) missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89,299,732 (GRCm39) missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89,331,870 (GRCm39) missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89,321,078 (GRCm39) missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89,306,538 (GRCm39) critical splice donor site probably null
IGL01804:Plxna1 APN 6 89,306,628 (GRCm39) missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89,309,066 (GRCm39) critical splice donor site probably null
IGL01989:Plxna1 APN 6 89,306,396 (GRCm39) nonsense probably null
IGL02015:Plxna1 APN 6 89,319,433 (GRCm39) missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89,334,314 (GRCm39) missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89,334,251 (GRCm39) nonsense probably null
IGL02703:Plxna1 APN 6 89,333,925 (GRCm39) missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89,301,649 (GRCm39) missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89,308,885 (GRCm39) missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89,334,411 (GRCm39) missense probably benign 0.14
R0055:Plxna1 UTSW 6 89,306,721 (GRCm39) missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89,306,721 (GRCm39) missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89,297,692 (GRCm39) missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89,297,595 (GRCm39) missense probably null 0.95
R0166:Plxna1 UTSW 6 89,310,001 (GRCm39) missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89,300,575 (GRCm39) missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89,334,318 (GRCm39) missense probably benign 0.12
R0841:Plxna1 UTSW 6 89,309,186 (GRCm39) missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89,319,942 (GRCm39) missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89,298,032 (GRCm39) missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89,297,748 (GRCm39) unclassified probably benign
R1700:Plxna1 UTSW 6 89,333,990 (GRCm39) missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89,312,446 (GRCm39) missense probably benign 0.00
R1957:Plxna1 UTSW 6 89,308,273 (GRCm39) missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89,301,298 (GRCm39) missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89,319,590 (GRCm39) missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89,333,958 (GRCm39) missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89,314,335 (GRCm39) critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89,334,435 (GRCm39) missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89,311,757 (GRCm39) unclassified probably benign
R3847:Plxna1 UTSW 6 89,333,501 (GRCm39) missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89,333,501 (GRCm39) missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89,309,674 (GRCm39) nonsense probably null
R4555:Plxna1 UTSW 6 89,300,310 (GRCm39) missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89,311,733 (GRCm39) missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89,299,798 (GRCm39) missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89,309,657 (GRCm39) splice site probably null
R5053:Plxna1 UTSW 6 89,299,442 (GRCm39) missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89,297,998 (GRCm39) missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89,300,590 (GRCm39) missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89,301,616 (GRCm39) missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89,301,523 (GRCm39) missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89,333,511 (GRCm39) missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89,311,664 (GRCm39) missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89,310,087 (GRCm39) missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89,299,704 (GRCm39) splice site probably benign
R5988:Plxna1 UTSW 6 89,334,522 (GRCm39) nonsense probably null
R6190:Plxna1 UTSW 6 89,333,586 (GRCm39) nonsense probably null
R6425:Plxna1 UTSW 6 89,311,647 (GRCm39) missense probably benign 0.00
R6561:Plxna1 UTSW 6 89,333,960 (GRCm39) missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89,299,753 (GRCm39) missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89,301,382 (GRCm39) missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89,296,430 (GRCm39) missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89,297,597 (GRCm39) missense probably benign 0.01
R6911:Plxna1 UTSW 6 89,297,956 (GRCm39) missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89,334,311 (GRCm39) missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89,300,311 (GRCm39) missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89,317,573 (GRCm39) missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89,334,584 (GRCm39) missense unknown
R7511:Plxna1 UTSW 6 89,318,889 (GRCm39) missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89,299,837 (GRCm39) missense probably damaging 1.00
R7678:Plxna1 UTSW 6 89,308,882 (GRCm39) missense probably damaging 0.99
R7748:Plxna1 UTSW 6 89,314,335 (GRCm39) critical splice acceptor site probably null
R7748:Plxna1 UTSW 6 89,314,334 (GRCm39) critical splice acceptor site probably null
R7877:Plxna1 UTSW 6 89,300,241 (GRCm39) missense probably damaging 0.99
R8025:Plxna1 UTSW 6 89,308,254 (GRCm39) missense probably damaging 1.00
R8171:Plxna1 UTSW 6 89,334,102 (GRCm39) missense probably benign 0.20
R8277:Plxna1 UTSW 6 89,334,162 (GRCm39) missense probably damaging 1.00
R8782:Plxna1 UTSW 6 89,300,220 (GRCm39) missense probably damaging 1.00
R8867:Plxna1 UTSW 6 89,310,079 (GRCm39) missense probably benign 0.00
R9245:Plxna1 UTSW 6 89,314,320 (GRCm39) missense probably damaging 1.00
R9253:Plxna1 UTSW 6 89,334,522 (GRCm39) nonsense probably null
R9269:Plxna1 UTSW 6 89,306,541 (GRCm39) missense probably null 1.00
R9273:Plxna1 UTSW 6 89,296,364 (GRCm39) missense possibly damaging 0.77
R9281:Plxna1 UTSW 6 89,300,313 (GRCm39) missense probably damaging 1.00
R9368:Plxna1 UTSW 6 89,314,138 (GRCm39) missense probably benign
R9440:Plxna1 UTSW 6 89,318,912 (GRCm39) missense probably benign 0.00
R9526:Plxna1 UTSW 6 89,319,633 (GRCm39) missense probably benign
R9601:Plxna1 UTSW 6 89,308,253 (GRCm39) missense probably damaging 1.00
R9714:Plxna1 UTSW 6 89,296,440 (GRCm39) missense probably damaging 0.99
R9782:Plxna1 UTSW 6 89,333,817 (GRCm39) missense probably benign 0.01
S24628:Plxna1 UTSW 6 89,334,318 (GRCm39) missense probably benign 0.12
V8831:Plxna1 UTSW 6 89,334,119 (GRCm39) missense probably damaging 0.99
Z1176:Plxna1 UTSW 6 89,298,034 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACGGTGTCACAGTTCAG -3'
(R):5'- CTTAAAGGGCTGACAGGTCC -3'

Sequencing Primer
(F):5'- AGTTCAGCCCCTTCACAGG -3'
(R):5'- TTAAAGGGCTGACAGGTCCAATCC -3'
Posted On 2019-11-12