Mutagenetix > Incidental Mutation

Incidental Mutation 'R7665:Actn4'

591857

Institutional Source

Beutler Lab

Gene Symbol

Actn4

Ensembl Gene

ENSMUSG00000054808

Gene Name

actinin alpha 4

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.784) question?

Stock #

R7665 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28893248-28962340 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28916207 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 147 (I147T)

Ref Sequence

ENSEMBL: ENSMUSP00000066068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068045] [ENSMUST00000127210] [ENSMUST00000140622] [ENSMUST00000148196] [ENSMUST00000217157]

AlphaFold

P57780

Predicted Effect

probably damaging
Transcript: ENSMUST00000068045
AA Change: I147T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808
AA Change: I147T

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
CH	53	153	1.08e-24	SMART
CH	166	265	3.49e-24	SMART
SPEC	297	403	2.83e0	SMART
SPEC	417	518	3.78e-23	SMART
SPEC	532	639	8.64e-9	SMART
SPEC	653	752	3.56e0	SMART
EFh	770	798	1.92e-3	SMART
EFh	811	839	1.56e-3	SMART
efhand_Ca_insen	842	908	1.27e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127210
AA Change: I147T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808
AA Change: I147T

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
CH	53	153	1.08e-24	SMART
CH	166	265	1.03e-21	SMART
SPEC	297	403	2.83e0	SMART
SPEC	417	518	3.78e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000140622
AA Change: I62T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123210
Gene: ENSMUSG00000054808
AA Change: I62T

Domain	Start	End	E-Value	Type
CH	3	68	1.09e-1	SMART
CH	81	180	3.49e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000148196
AA Change: I62T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122268
Gene: ENSMUSG00000054808
AA Change: I62T

Domain	Start	End	E-Value	Type
CH	3	68	1.09e-1	SMART
Pfam:CH	82	133	4.5e-11	PFAM
Pfam:CAMSAP_CH	89	133	9.1e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000217157
AA Change: I147T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die either around birth or within a few months of birth. Those who do survive after birth show poor growth and kidney abnormalities including glomerulosclerosis. This is manifested functionally as proteinuria and abnormal blood urea nitrogen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	A	G	5: 114,874,323		probably null	Het
A830018L16Rik	T	C	1: 11,972,099	S448P	probably damaging	Het
Abca4	C	T	3: 122,044,490		probably benign	Het
Ackr2	A	G	9: 121,909,308	M250V	probably benign	Het
Adgrv1	C	T	13: 81,499,142	S3093N	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Brwd1	G	A	16: 96,041,343	T798M	probably benign	Het
Cdk13	G	A	13: 17,772,553	T540I	possibly damaging	Het
Cdkn1c	A	G	7: 143,460,634	V25A	possibly damaging	Het
Col2a1	T	C	15: 97,976,700	E1420G	unknown	Het
Dbf4	G	A	5: 8,397,867	P448S	probably damaging	Het
Dnajb7	T	C	15: 81,407,419	N239S	probably benign	Het
Dnttip1	A	G	2: 164,754,141	D102G	probably damaging	Het
Dpp8	T	A	9: 65,078,718	V830D	probably damaging	Het
Eef1g	T	C	19: 8,968,289	V29A	probably benign	Het
Enpp2	T	A	15: 54,839,394	Y906F	probably damaging	Het
Epb41l4a	A	G	18: 34,006,016	L23P	possibly damaging	Het
Epp13	G	A	7: 6,269,892		probably null	Het
Exoc1	T	A	5: 76,543,573	M248K	probably benign	Het
Fam83b	T	C	9: 76,490,875	Y982C	probably damaging	Het
Fat4	C	T	3: 38,889,178	A740V	probably benign	Het
Fsip2	T	A	2: 82,981,805	S2823T	probably benign	Het
Gckr	T	C	5: 31,297,555			Het
Gpr150	A	T	13: 76,055,974	V284E	probably damaging	Het
Grtp1	T	G	8: 13,177,103	I344L	probably benign	Het
Heatr5a	T	A	12: 51,961,530	N10I	probably damaging	Het
Herc2	C	A	7: 56,153,155	L2109I	probably damaging	Het
Hs1bp3	T	A	12: 8,317,935	D61E	probably damaging	Het
Ifit1bl1	T	A	19: 34,594,883	Y58F	probably benign	Het
Itfg1	A	G	8: 85,764,350	F317L	probably benign	Het
Itsn1	T	C	16: 91,841,603	I764T	unknown	Het
Med8	A	C	4: 118,411,656		probably null	Het
Mpeg1	C	A	19: 12,463,094	P639T	probably damaging	Het
Nedd9	A	G	13: 41,316,309	L456P	probably benign	Het
Neo1	A	G	9: 58,925,795	S556P	probably damaging	Het
Nphp3	T	A	9: 104,005,393		probably null	Het
Nup205	T	C	6: 35,177,620	V53A	possibly damaging	Het
Nvl	A	T	1: 181,134,944	S154T	probably benign	Het
Olfr239	G	T	17: 33,199,629	G194*	probably null	Het
Olfr391-ps	A	T	11: 73,798,961	N265K	probably benign	Het
Olfr615	A	T	7: 103,561,316	I280F	probably benign	Het
Olfr706	A	T	7: 106,886,673	V48D	possibly damaging	Het
Olfr827	T	A	10: 130,211,261		probably null	Het
Olfr92	A	G	17: 37,111,391	M197T	probably benign	Het
Parvg	T	C	15: 84,337,801	I243T	probably damaging	Het
Paxip1	T	A	5: 27,765,738	M538L	unknown	Het
Pgghg	G	T	7: 140,945,469	D428Y	probably damaging	Het
Pik3cd	C	T	4: 149,654,050	V777M	possibly damaging	Het
Plcl2	A	C	17: 50,607,157	K398T	probably benign	Het
Plxna1	A	T	6: 89,324,538		probably null	Het
Rbbp6	T	C	7: 122,994,686	Y514H	possibly damaging	Het
Rbbp6	T	A	7: 122,990,032		probably null	Het
Scin	T	A	12: 40,069,415	N538I	probably damaging	Het
Sdcbp	A	G	4: 6,385,144	D121G	probably benign	Het
Sgk1	T	C	10: 21,996,662	I311T	probably damaging	Het
Shq1	A	C	6: 100,573,756	L407W	probably damaging	Het
Sipa1	A	T	19: 5,651,671	S979T	probably benign	Het
Slc25a37	G	T	14: 69,249,579	T85K	probably benign	Het
Soga3	T	A	10: 29,196,397	Y562N	probably damaging	Het
Spag9	A	T	11: 94,013,654	Q112L	probably damaging	Het
Spg11	A	T	2: 122,066,267	V1686E	probably damaging	Het
Stap2	A	G	17: 55,997,909	V291A	probably benign	Het
Tnk2	C	T	16: 32,680,526	R886C	probably damaging	Het
Tnrc6c	T	A	11: 117,720,951	D138E	possibly damaging	Het
Unc13c	A	G	9: 73,680,474	S1426P	probably benign	Het
Vav1	G	A	17: 57,297,086	V163M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,988	K247*	probably null	Het
Zc2hc1c	T	C	12: 85,296,562	V491A	possibly damaging	Het
Zfp51	A	G	17: 21,463,581	T153A	probably benign	Het
Zyx	A	G	6: 42,356,162	E374G	probably damaging	Het

Other mutations in Actn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Actn4	APN	7	28904684	missense	probably damaging	1.00
IGL02127:Actn4	APN	7	28897880	missense	probably benign
IGL02192:Actn4	APN	7	28898400	missense	possibly damaging	0.93
IGL02862:Actn4	APN	7	28912234	splice site	probably benign
IGL03339:Actn4	APN	7	28901982	missense	probably damaging	1.00
R0067:Actn4	UTSW	7	28911570	missense	possibly damaging	0.67
R0067:Actn4	UTSW	7	28911570	missense	possibly damaging	0.67
R0243:Actn4	UTSW	7	28905398	missense	probably benign	0.29
R0689:Actn4	UTSW	7	28897049	missense	probably damaging	1.00
R0845:Actn4	UTSW	7	28913430	missense	probably damaging	1.00
R1469:Actn4	UTSW	7	28905328	missense	probably benign	0.15
R1469:Actn4	UTSW	7	28898266	splice site	probably benign
R1469:Actn4	UTSW	7	28905328	missense	probably benign	0.15
R1581:Actn4	UTSW	7	28898646	missense	probably benign	0.04
R1690:Actn4	UTSW	7	28911525	missense	probably damaging	1.00
R1962:Actn4	UTSW	7	28894622	missense	probably damaging	1.00
R2113:Actn4	UTSW	7	28898124	missense	probably benign	0.42
R2215:Actn4	UTSW	7	28918753	missense	possibly damaging	0.88
R2429:Actn4	UTSW	7	28898071	missense	probably benign	0.00
R3945:Actn4	UTSW	7	28912236	splice site	probably null
R3962:Actn4	UTSW	7	28898222	splice site	probably null
R3970:Actn4	UTSW	7	28962032	missense	probably benign
R4909:Actn4	UTSW	7	28898657	missense	probably damaging	1.00
R4985:Actn4	UTSW	7	28918986	missense	probably damaging	1.00
R5155:Actn4	UTSW	7	28962017	critical splice donor site	probably null
R5201:Actn4	UTSW	7	28916255	splice site	probably null
R5668:Actn4	UTSW	7	28904550	missense	probably damaging	1.00
R5818:Actn4	UTSW	7	28919019	missense	probably damaging	1.00
R6046:Actn4	UTSW	7	28904619	missense	probably benign	0.03
R6155:Actn4	UTSW	7	28896141	missense	probably damaging	1.00
R6559:Actn4	UTSW	7	28907036	missense	possibly damaging	0.87
R7224:Actn4	UTSW	7	28962084	missense	probably benign	0.08
R7225:Actn4	UTSW	7	28898699	missense	probably damaging	1.00
R7423:Actn4	UTSW	7	28894255	missense	probably damaging	0.97
R7704:Actn4	UTSW	7	28897042	missense	possibly damaging	0.76
R8096:Actn4	UTSW	7	28894583	missense	possibly damaging	0.88
R8096:Actn4	UTSW	7	28901913	missense	probably damaging	1.00
R8954:Actn4	UTSW	7	28895158	missense	probably damaging	0.96
R8987:Actn4	UTSW	7	28896973	missense	probably benign	0.00
R9128:Actn4	UTSW	7	28894504	missense	possibly damaging	0.90
R9507:Actn4	UTSW	7	28906972	missense	probably benign	0.00
R9574:Actn4	UTSW	7	28895439	missense	probably benign	0.03
R9746:Actn4	UTSW	7	28919006	missense	probably benign
Z1088:Actn4	UTSW	7	28894578	missense	probably damaging	1.00
Z1177:Actn4	UTSW	7	28919049	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTGTATGAAATAGAGGCCAC -3'
(R):5'- TCAGAGGCTTAGGGACAGTG -3'

Sequencing Primer
(F):5'- TAGAGGCCACAGAGCACTGC -3'
(R):5'- CTTAGGGACAGTGCCAGCAG -3'

Posted On

2019-11-12