Incidental Mutation 'R7665:Actn4'
ID 591857
Institutional Source Beutler Lab
Gene Symbol Actn4
Ensembl Gene ENSMUSG00000054808
Gene Name actinin alpha 4
Synonyms
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.752) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 28592673-28661765 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28615632 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 147 (I147T)
Ref Sequence ENSEMBL: ENSMUSP00000066068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068045] [ENSMUST00000127210] [ENSMUST00000140622] [ENSMUST00000148196] [ENSMUST00000217157]
AlphaFold P57780
Predicted Effect probably damaging
Transcript: ENSMUST00000068045
AA Change: I147T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808
AA Change: I147T

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 3.49e-24 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
SPEC 532 639 8.64e-9 SMART
SPEC 653 752 3.56e0 SMART
EFh 770 798 1.92e-3 SMART
EFh 811 839 1.56e-3 SMART
efhand_Ca_insen 842 908 1.27e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127210
AA Change: I147T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808
AA Change: I147T

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140622
AA Change: I62T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123210
Gene: ENSMUSG00000054808
AA Change: I62T

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
CH 81 180 3.49e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148196
AA Change: I62T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122268
Gene: ENSMUSG00000054808
AA Change: I62T

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
Pfam:CH 82 133 4.5e-11 PFAM
Pfam:CAMSAP_CH 89 133 9.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217157
AA Change: I147T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die either around birth or within a few months of birth. Those who do survive after birth show poor growth and kidney abnormalities including glomerulosclerosis. This is manifested functionally as proteinuria and abnormal blood urea nitrogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Actn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Actn4 APN 7 28,604,109 (GRCm39) missense probably damaging 1.00
IGL02127:Actn4 APN 7 28,597,305 (GRCm39) missense probably benign
IGL02192:Actn4 APN 7 28,597,825 (GRCm39) missense possibly damaging 0.93
IGL02862:Actn4 APN 7 28,611,659 (GRCm39) splice site probably benign
IGL03339:Actn4 APN 7 28,601,407 (GRCm39) missense probably damaging 1.00
R0067:Actn4 UTSW 7 28,610,995 (GRCm39) missense possibly damaging 0.67
R0067:Actn4 UTSW 7 28,610,995 (GRCm39) missense possibly damaging 0.67
R0243:Actn4 UTSW 7 28,604,823 (GRCm39) missense probably benign 0.29
R0689:Actn4 UTSW 7 28,596,474 (GRCm39) missense probably damaging 1.00
R0845:Actn4 UTSW 7 28,612,855 (GRCm39) missense probably damaging 1.00
R1469:Actn4 UTSW 7 28,604,753 (GRCm39) missense probably benign 0.15
R1469:Actn4 UTSW 7 28,604,753 (GRCm39) missense probably benign 0.15
R1469:Actn4 UTSW 7 28,597,691 (GRCm39) splice site probably benign
R1581:Actn4 UTSW 7 28,598,071 (GRCm39) missense probably benign 0.04
R1690:Actn4 UTSW 7 28,610,950 (GRCm39) missense probably damaging 1.00
R1962:Actn4 UTSW 7 28,594,047 (GRCm39) missense probably damaging 1.00
R2113:Actn4 UTSW 7 28,597,549 (GRCm39) missense probably benign 0.42
R2215:Actn4 UTSW 7 28,618,178 (GRCm39) missense possibly damaging 0.88
R2429:Actn4 UTSW 7 28,597,496 (GRCm39) missense probably benign 0.00
R3945:Actn4 UTSW 7 28,611,661 (GRCm39) splice site probably null
R3962:Actn4 UTSW 7 28,597,647 (GRCm39) splice site probably null
R3970:Actn4 UTSW 7 28,661,457 (GRCm39) missense probably benign
R4909:Actn4 UTSW 7 28,598,082 (GRCm39) missense probably damaging 1.00
R4985:Actn4 UTSW 7 28,618,411 (GRCm39) missense probably damaging 1.00
R5155:Actn4 UTSW 7 28,661,442 (GRCm39) critical splice donor site probably null
R5201:Actn4 UTSW 7 28,615,680 (GRCm39) splice site probably null
R5668:Actn4 UTSW 7 28,603,975 (GRCm39) missense probably damaging 1.00
R5818:Actn4 UTSW 7 28,618,444 (GRCm39) missense probably damaging 1.00
R6046:Actn4 UTSW 7 28,604,044 (GRCm39) missense probably benign 0.03
R6155:Actn4 UTSW 7 28,595,566 (GRCm39) missense probably damaging 1.00
R6559:Actn4 UTSW 7 28,606,461 (GRCm39) missense possibly damaging 0.87
R7224:Actn4 UTSW 7 28,661,509 (GRCm39) missense probably benign 0.08
R7225:Actn4 UTSW 7 28,598,124 (GRCm39) missense probably damaging 1.00
R7423:Actn4 UTSW 7 28,593,680 (GRCm39) missense probably damaging 0.97
R7704:Actn4 UTSW 7 28,596,467 (GRCm39) missense possibly damaging 0.76
R8096:Actn4 UTSW 7 28,601,338 (GRCm39) missense probably damaging 1.00
R8096:Actn4 UTSW 7 28,594,008 (GRCm39) missense possibly damaging 0.88
R8954:Actn4 UTSW 7 28,594,583 (GRCm39) missense probably damaging 0.96
R8987:Actn4 UTSW 7 28,596,398 (GRCm39) missense probably benign 0.00
R9128:Actn4 UTSW 7 28,593,929 (GRCm39) missense possibly damaging 0.90
R9507:Actn4 UTSW 7 28,606,397 (GRCm39) missense probably benign 0.00
R9574:Actn4 UTSW 7 28,594,864 (GRCm39) missense probably benign 0.03
R9746:Actn4 UTSW 7 28,618,431 (GRCm39) missense probably benign
Z1088:Actn4 UTSW 7 28,594,003 (GRCm39) missense probably damaging 1.00
Z1177:Actn4 UTSW 7 28,618,474 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGTATGAAATAGAGGCCAC -3'
(R):5'- TCAGAGGCTTAGGGACAGTG -3'

Sequencing Primer
(F):5'- TAGAGGCCACAGAGCACTGC -3'
(R):5'- CTTAGGGACAGTGCCAGCAG -3'
Posted On 2019-11-12