Incidental Mutation 'R7665:Herc2'
ID 591858
Institutional Source Beutler Lab
Gene Symbol Herc2
Ensembl Gene ENSMUSG00000030451
Gene Name HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms D7H15F32S1, D7H15F37S1, D15F32S1h, rjs, jdf2
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 55699944-55881548 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 55802903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 2109 (L2109I)
Ref Sequence ENSEMBL: ENSMUSP00000075579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076226
AA Change: L2109I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451
AA Change: L2109I

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 7.6e-16 PFAM
Pfam:RCC1_2 554 583 6e-9 PFAM
Pfam:RCC1 570 615 7.1e-17 PFAM
Pfam:RCC1_2 606 637 6.9e-8 PFAM
Pfam:RCC1 624 673 7.2e-15 PFAM
Pfam:RCC1 676 725 3.3e-18 PFAM
Pfam:RCC1_2 712 740 1.6e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1933 5.8e-29 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2633 2.6e-43 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 9.2e-8 PFAM
Pfam:RCC1 3066 3115 3.7e-17 PFAM
Pfam:RCC1_2 3102 3131 3.9e-11 PFAM
Pfam:RCC1 3118 3162 1.9e-15 PFAM
Pfam:RCC1 3172 3221 9.6e-15 PFAM
Pfam:RCC1_2 3208 3236 2.2e-7 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 5.1e-8 PFAM
Pfam:RCC1 4059 4108 1.5e-16 PFAM
Pfam:RCC1 4111 4155 7.9e-16 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 4.3e-10 PFAM
Pfam:RCC1 4269 4318 1.2e-17 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164095
AA Change: L2109I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451
AA Change: L2109I

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 2.9e-15 PFAM
Pfam:RCC1_2 554 583 1.6e-8 PFAM
Pfam:RCC1 570 615 2.3e-16 PFAM
Pfam:RCC1 624 673 1.2e-14 PFAM
Pfam:RCC1_2 660 689 2.1e-7 PFAM
Pfam:RCC1 676 725 9.8e-18 PFAM
Pfam:RCC1_2 712 740 1.1e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1931 9.3e-25 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2632 1.4e-39 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 1.6e-7 PFAM
Pfam:RCC1 3066 3115 7.1e-16 PFAM
Pfam:RCC1_2 3102 3131 7.1e-11 PFAM
Pfam:RCC1 3118 3163 1.2e-14 PFAM
Pfam:RCC1 3172 3221 4.7e-15 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 1.2e-7 PFAM
Pfam:RCC1 4059 4108 9.6e-15 PFAM
Pfam:RCC1 4111 4156 5.6e-15 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 7.3e-10 PFAM
Pfam:RCC1 4269 4318 1.6e-16 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205303
AA Change: L2109I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Herc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Herc2 APN 7 55,774,047 (GRCm39) missense probably damaging 1.00
IGL00529:Herc2 APN 7 55,807,501 (GRCm39) missense probably benign
IGL00548:Herc2 APN 7 55,856,313 (GRCm39) missense probably benign 0.20
IGL00970:Herc2 APN 7 55,830,812 (GRCm39) splice site probably benign
IGL01141:Herc2 APN 7 55,862,589 (GRCm39) missense possibly damaging 0.47
IGL01147:Herc2 APN 7 55,806,697 (GRCm39) missense probably benign 0.43
IGL01150:Herc2 APN 7 55,830,881 (GRCm39) missense probably damaging 1.00
IGL01519:Herc2 APN 7 55,753,698 (GRCm39) missense probably damaging 1.00
IGL01576:Herc2 APN 7 55,876,409 (GRCm39) critical splice donor site probably null
IGL01626:Herc2 APN 7 55,734,890 (GRCm39) missense probably benign 0.02
IGL01658:Herc2 APN 7 55,809,200 (GRCm39) missense probably damaging 1.00
IGL01707:Herc2 APN 7 55,814,935 (GRCm39) missense probably damaging 1.00
IGL01727:Herc2 APN 7 55,787,554 (GRCm39) missense probably damaging 1.00
IGL01935:Herc2 APN 7 55,803,541 (GRCm39) missense probably benign
IGL01969:Herc2 APN 7 55,835,579 (GRCm39) splice site probably benign
IGL02074:Herc2 APN 7 55,737,192 (GRCm39) splice site probably benign
IGL02261:Herc2 APN 7 55,856,492 (GRCm39) missense probably damaging 0.99
IGL02339:Herc2 APN 7 55,771,470 (GRCm39) missense probably benign 0.01
IGL02353:Herc2 APN 7 55,764,560 (GRCm39) missense probably damaging 1.00
IGL02360:Herc2 APN 7 55,764,560 (GRCm39) missense probably damaging 1.00
IGL02409:Herc2 APN 7 55,870,217 (GRCm39) splice site probably null
IGL02528:Herc2 APN 7 55,758,641 (GRCm39) splice site probably benign
IGL02571:Herc2 APN 7 55,803,134 (GRCm39) missense probably damaging 1.00
IGL02578:Herc2 APN 7 55,756,283 (GRCm39) splice site probably null
IGL02661:Herc2 APN 7 55,762,821 (GRCm39) missense probably damaging 1.00
IGL02664:Herc2 APN 7 55,785,426 (GRCm39) nonsense probably null
IGL02675:Herc2 APN 7 55,813,849 (GRCm39) missense probably damaging 0.99
IGL02689:Herc2 APN 7 55,815,031 (GRCm39) splice site probably benign
IGL02710:Herc2 APN 7 55,787,562 (GRCm39) missense possibly damaging 0.95
IGL02750:Herc2 APN 7 55,854,127 (GRCm39) splice site probably benign
IGL02754:Herc2 APN 7 55,747,246 (GRCm39) missense probably damaging 1.00
IGL03029:Herc2 APN 7 55,818,715 (GRCm39) missense probably damaging 1.00
IGL03039:Herc2 APN 7 55,818,769 (GRCm39) splice site probably benign
IGL03082:Herc2 APN 7 55,835,671 (GRCm39) missense probably benign 0.19
IGL03090:Herc2 APN 7 55,854,221 (GRCm39) missense probably damaging 0.96
IGL03154:Herc2 APN 7 55,851,907 (GRCm39) missense probably damaging 1.00
IGL03165:Herc2 APN 7 55,841,660 (GRCm39) missense probably damaging 1.00
IGL03201:Herc2 APN 7 55,869,516 (GRCm39) missense probably damaging 1.00
IGL03234:Herc2 APN 7 55,753,610 (GRCm39) missense probably damaging 1.00
IGL03293:Herc2 APN 7 55,804,878 (GRCm39) missense probably benign 0.43
IGL03331:Herc2 APN 7 55,785,015 (GRCm39) splice site probably benign
IGL03340:Herc2 APN 7 55,740,668 (GRCm39) missense possibly damaging 0.51
IGL03409:Herc2 APN 7 55,878,317 (GRCm39) missense probably damaging 1.00
alarmed UTSW 7 55,879,410 (GRCm39) missense possibly damaging 0.92
hyper UTSW 7 55,809,165 (GRCm39) missense probably damaging 1.00
R0798_herc2_487 UTSW 7 55,785,431 (GRCm39) critical splice donor site probably null
R1370_Herc2_948 UTSW 7 55,818,621 (GRCm39) missense probably benign 0.01
R2030_Herc2_144 UTSW 7 55,834,121 (GRCm39) missense probably damaging 0.99
uptight UTSW 7 55,762,958 (GRCm39) missense probably damaging 1.00
I0000:Herc2 UTSW 7 55,786,477 (GRCm39) splice site probably benign
PIT1430001:Herc2 UTSW 7 55,876,702 (GRCm39) missense probably damaging 1.00
R0009:Herc2 UTSW 7 55,857,560 (GRCm39) missense probably benign 0.03
R0009:Herc2 UTSW 7 55,857,560 (GRCm39) missense probably benign 0.03
R0058:Herc2 UTSW 7 55,820,231 (GRCm39) missense possibly damaging 0.93
R0114:Herc2 UTSW 7 55,803,522 (GRCm39) splice site probably benign
R0117:Herc2 UTSW 7 55,863,359 (GRCm39) splice site probably benign
R0141:Herc2 UTSW 7 55,771,309 (GRCm39) missense probably benign 0.17
R0266:Herc2 UTSW 7 55,856,326 (GRCm39) missense probably damaging 1.00
R0401:Herc2 UTSW 7 55,807,480 (GRCm39) missense probably damaging 0.99
R0403:Herc2 UTSW 7 55,809,165 (GRCm39) missense probably damaging 1.00
R0437:Herc2 UTSW 7 55,869,563 (GRCm39) nonsense probably null
R0491:Herc2 UTSW 7 55,772,114 (GRCm39) missense possibly damaging 0.54
R0499:Herc2 UTSW 7 55,834,117 (GRCm39) nonsense probably null
R0580:Herc2 UTSW 7 55,788,539 (GRCm39) missense probably damaging 1.00
R0650:Herc2 UTSW 7 55,762,958 (GRCm39) missense probably damaging 1.00
R0744:Herc2 UTSW 7 55,855,784 (GRCm39) splice site probably benign
R0798:Herc2 UTSW 7 55,785,431 (GRCm39) critical splice donor site probably null
R0842:Herc2 UTSW 7 55,771,453 (GRCm39) missense probably benign
R0849:Herc2 UTSW 7 55,856,326 (GRCm39) missense probably damaging 1.00
R0850:Herc2 UTSW 7 55,854,231 (GRCm39) missense probably benign 0.09
R0926:Herc2 UTSW 7 55,782,296 (GRCm39) missense possibly damaging 0.67
R1146:Herc2 UTSW 7 55,796,444 (GRCm39) missense probably benign
R1146:Herc2 UTSW 7 55,796,444 (GRCm39) missense probably benign
R1292:Herc2 UTSW 7 55,846,951 (GRCm39) missense probably benign 0.05
R1370:Herc2 UTSW 7 55,818,621 (GRCm39) missense probably benign 0.01
R1443:Herc2 UTSW 7 55,854,481 (GRCm39) missense possibly damaging 0.69
R1445:Herc2 UTSW 7 55,818,744 (GRCm39) missense probably damaging 1.00
R1541:Herc2 UTSW 7 55,785,405 (GRCm39) missense probably damaging 1.00
R1550:Herc2 UTSW 7 55,785,406 (GRCm39) missense probably damaging 1.00
R1551:Herc2 UTSW 7 55,796,417 (GRCm39) missense probably benign 0.01
R1633:Herc2 UTSW 7 55,879,117 (GRCm39) missense probably null 1.00
R1635:Herc2 UTSW 7 55,786,415 (GRCm39) missense probably benign 0.00
R1659:Herc2 UTSW 7 55,784,853 (GRCm39) missense probably benign 0.00
R1682:Herc2 UTSW 7 55,738,148 (GRCm39) missense possibly damaging 0.87
R1697:Herc2 UTSW 7 55,803,653 (GRCm39) missense probably benign 0.43
R1748:Herc2 UTSW 7 55,798,571 (GRCm39) critical splice donor site probably null
R1802:Herc2 UTSW 7 55,834,080 (GRCm39) missense probably damaging 1.00
R1835:Herc2 UTSW 7 55,856,513 (GRCm39) nonsense probably null
R1836:Herc2 UTSW 7 55,804,853 (GRCm39) nonsense probably null
R1872:Herc2 UTSW 7 55,807,257 (GRCm39) missense probably benign 0.18
R1889:Herc2 UTSW 7 55,839,561 (GRCm39) missense possibly damaging 0.60
R1906:Herc2 UTSW 7 55,764,612 (GRCm39) missense probably benign 0.01
R2004:Herc2 UTSW 7 55,787,607 (GRCm39) missense probably damaging 1.00
R2030:Herc2 UTSW 7 55,834,121 (GRCm39) missense probably damaging 0.99
R2037:Herc2 UTSW 7 55,855,709 (GRCm39) missense probably damaging 1.00
R2059:Herc2 UTSW 7 55,813,645 (GRCm39) missense probably damaging 1.00
R2068:Herc2 UTSW 7 55,782,245 (GRCm39) missense probably damaging 1.00
R2072:Herc2 UTSW 7 55,876,712 (GRCm39) missense probably damaging 1.00
R2085:Herc2 UTSW 7 55,862,713 (GRCm39) missense possibly damaging 0.94
R2115:Herc2 UTSW 7 55,835,576 (GRCm39) splice site probably benign
R2160:Herc2 UTSW 7 55,862,670 (GRCm39) missense probably benign 0.00
R2173:Herc2 UTSW 7 55,835,699 (GRCm39) missense probably benign 0.27
R2221:Herc2 UTSW 7 55,818,766 (GRCm39) critical splice donor site probably null
R2280:Herc2 UTSW 7 55,787,019 (GRCm39) missense possibly damaging 0.79
R3078:Herc2 UTSW 7 55,786,991 (GRCm39) missense probably benign
R3104:Herc2 UTSW 7 55,785,103 (GRCm39) missense probably benign 0.23
R3177:Herc2 UTSW 7 55,803,176 (GRCm39) missense probably benign 0.00
R3277:Herc2 UTSW 7 55,803,176 (GRCm39) missense probably benign 0.00
R3766:Herc2 UTSW 7 55,813,572 (GRCm39) missense probably damaging 1.00
R3770:Herc2 UTSW 7 55,814,755 (GRCm39) missense probably benign
R3807:Herc2 UTSW 7 55,857,557 (GRCm39) missense probably damaging 1.00
R3912:Herc2 UTSW 7 55,748,185 (GRCm39) missense probably damaging 0.98
R4004:Herc2 UTSW 7 55,756,213 (GRCm39) missense possibly damaging 0.53
R4039:Herc2 UTSW 7 55,806,159 (GRCm39) missense probably damaging 0.98
R4190:Herc2 UTSW 7 55,772,196 (GRCm39) missense probably benign 0.03
R4225:Herc2 UTSW 7 55,814,735 (GRCm39) missense probably damaging 1.00
R4334:Herc2 UTSW 7 55,876,402 (GRCm39) missense probably damaging 1.00
R4405:Herc2 UTSW 7 55,820,225 (GRCm39) missense probably damaging 1.00
R4448:Herc2 UTSW 7 55,877,640 (GRCm39) missense probably damaging 1.00
R4450:Herc2 UTSW 7 55,877,640 (GRCm39) missense probably damaging 1.00
R4565:Herc2 UTSW 7 55,803,586 (GRCm39) missense possibly damaging 0.71
R4667:Herc2 UTSW 7 55,781,001 (GRCm39) missense probably damaging 1.00
R4747:Herc2 UTSW 7 55,756,141 (GRCm39) missense possibly damaging 0.80
R4762:Herc2 UTSW 7 55,820,388 (GRCm39) missense probably benign 0.19
R4829:Herc2 UTSW 7 55,756,240 (GRCm39) missense probably benign 0.39
R4832:Herc2 UTSW 7 55,748,165 (GRCm39) nonsense probably null
R4895:Herc2 UTSW 7 55,872,734 (GRCm39) missense probably damaging 1.00
R4904:Herc2 UTSW 7 55,807,234 (GRCm39) missense probably damaging 0.99
R4908:Herc2 UTSW 7 55,827,660 (GRCm39) missense probably benign 0.01
R4911:Herc2 UTSW 7 55,877,640 (GRCm39) missense probably damaging 1.00
R4921:Herc2 UTSW 7 55,879,438 (GRCm39) missense probably benign 0.04
R4939:Herc2 UTSW 7 55,856,484 (GRCm39) missense probably damaging 1.00
R5155:Herc2 UTSW 7 55,877,574 (GRCm39) missense possibly damaging 0.85
R5184:Herc2 UTSW 7 55,772,099 (GRCm39) missense probably damaging 1.00
R5269:Herc2 UTSW 7 55,818,618 (GRCm39) nonsense probably null
R5306:Herc2 UTSW 7 55,834,709 (GRCm39) missense probably damaging 1.00
R5314:Herc2 UTSW 7 55,869,534 (GRCm39) missense probably damaging 0.99
R5369:Herc2 UTSW 7 55,832,448 (GRCm39) missense probably damaging 1.00
R5418:Herc2 UTSW 7 55,787,313 (GRCm39) missense probably damaging 1.00
R5420:Herc2 UTSW 7 55,853,578 (GRCm39) missense probably damaging 0.96
R5463:Herc2 UTSW 7 55,844,010 (GRCm39) missense probably damaging 1.00
R5510:Herc2 UTSW 7 55,856,519 (GRCm39) missense probably damaging 1.00
R5634:Herc2 UTSW 7 55,856,531 (GRCm39) missense probably damaging 1.00
R5638:Herc2 UTSW 7 55,854,164 (GRCm39) missense probably benign 0.01
R5690:Herc2 UTSW 7 55,807,453 (GRCm39) missense probably benign
R5762:Herc2 UTSW 7 55,846,938 (GRCm39) missense possibly damaging 0.68
R5807:Herc2 UTSW 7 55,880,667 (GRCm39) missense probably damaging 0.99
R5878:Herc2 UTSW 7 55,773,996 (GRCm39) missense probably benign
R6036:Herc2 UTSW 7 55,717,801 (GRCm39) missense probably benign 0.01
R6036:Herc2 UTSW 7 55,717,801 (GRCm39) missense probably benign 0.01
R6083:Herc2 UTSW 7 55,878,253 (GRCm39) missense probably benign 0.00
R6192:Herc2 UTSW 7 55,857,510 (GRCm39) missense probably damaging 1.00
R6193:Herc2 UTSW 7 55,806,649 (GRCm39) missense probably damaging 0.98
R6261:Herc2 UTSW 7 55,846,820 (GRCm39) nonsense probably null
R6267:Herc2 UTSW 7 55,802,914 (GRCm39) nonsense probably null
R6267:Herc2 UTSW 7 55,854,466 (GRCm39) missense possibly damaging 0.51
R6298:Herc2 UTSW 7 55,841,013 (GRCm39) missense probably benign
R6299:Herc2 UTSW 7 55,784,803 (GRCm39) missense possibly damaging 0.47
R6326:Herc2 UTSW 7 55,872,682 (GRCm39) missense probably damaging 0.98
R6347:Herc2 UTSW 7 55,844,151 (GRCm39) critical splice donor site probably null
R6394:Herc2 UTSW 7 55,865,729 (GRCm39) missense probably damaging 1.00
R6500:Herc2 UTSW 7 55,796,393 (GRCm39) nonsense probably null
R6526:Herc2 UTSW 7 55,807,078 (GRCm39) missense probably damaging 0.99
R6592:Herc2 UTSW 7 55,857,438 (GRCm39) critical splice acceptor site probably null
R6619:Herc2 UTSW 7 55,717,840 (GRCm39) nonsense probably null
R6719:Herc2 UTSW 7 55,862,574 (GRCm39) missense probably damaging 1.00
R6750:Herc2 UTSW 7 55,747,195 (GRCm39) missense probably damaging 1.00
R6807:Herc2 UTSW 7 55,814,670 (GRCm39) missense probably damaging 1.00
R6811:Herc2 UTSW 7 55,763,181 (GRCm39) nonsense probably null
R6837:Herc2 UTSW 7 55,839,589 (GRCm39) missense possibly damaging 0.89
R6838:Herc2 UTSW 7 55,758,526 (GRCm39) missense probably damaging 1.00
R6902:Herc2 UTSW 7 55,785,234 (GRCm39) missense probably benign 0.37
R6983:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R6985:Herc2 UTSW 7 55,782,228 (GRCm39) missense probably damaging 1.00
R6985:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R6986:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R6987:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R7113:Herc2 UTSW 7 55,853,597 (GRCm39) missense probably damaging 0.99
R7173:Herc2 UTSW 7 55,853,575 (GRCm39) missense probably damaging 1.00
R7202:Herc2 UTSW 7 55,781,034 (GRCm39) missense probably damaging 0.99
R7205:Herc2 UTSW 7 55,832,388 (GRCm39) missense probably damaging 1.00
R7236:Herc2 UTSW 7 55,734,828 (GRCm39) missense probably benign 0.29
R7297:Herc2 UTSW 7 55,786,406 (GRCm39) missense probably benign 0.00
R7358:Herc2 UTSW 7 55,832,423 (GRCm39) missense possibly damaging 0.48
R7438:Herc2 UTSW 7 55,753,466 (GRCm39) splice site probably null
R7537:Herc2 UTSW 7 55,869,527 (GRCm39) nonsense probably null
R7578:Herc2 UTSW 7 55,784,548 (GRCm39) missense probably benign 0.07
R7614:Herc2 UTSW 7 55,803,023 (GRCm39) nonsense probably null
R7638:Herc2 UTSW 7 55,870,273 (GRCm39) missense probably damaging 1.00
R7638:Herc2 UTSW 7 55,807,186 (GRCm39) missense probably benign 0.26
R7646:Herc2 UTSW 7 55,784,361 (GRCm39) missense probably benign
R7663:Herc2 UTSW 7 55,786,433 (GRCm39) missense probably benign
R7691:Herc2 UTSW 7 55,841,593 (GRCm39) missense probably benign
R7733:Herc2 UTSW 7 55,838,412 (GRCm39) missense probably damaging 0.99
R7767:Herc2 UTSW 7 55,878,275 (GRCm39) missense probably benign 0.39
R7802:Herc2 UTSW 7 55,813,838 (GRCm39) missense probably damaging 1.00
R7847:Herc2 UTSW 7 55,807,308 (GRCm39) critical splice donor site probably null
R7956:Herc2 UTSW 7 55,763,148 (GRCm39) missense probably damaging 0.97
R7985:Herc2 UTSW 7 55,814,992 (GRCm39) missense probably benign
R8003:Herc2 UTSW 7 55,818,652 (GRCm39) missense possibly damaging 0.94
R8045:Herc2 UTSW 7 55,834,648 (GRCm39) missense probably damaging 1.00
R8085:Herc2 UTSW 7 55,879,427 (GRCm39) missense probably benign 0.01
R8134:Herc2 UTSW 7 55,734,884 (GRCm39) missense probably benign 0.10
R8259:Herc2 UTSW 7 55,855,638 (GRCm39) missense probably damaging 0.99
R8286:Herc2 UTSW 7 55,879,410 (GRCm39) missense possibly damaging 0.92
R8304:Herc2 UTSW 7 55,809,186 (GRCm39) missense probably damaging 1.00
R8321:Herc2 UTSW 7 55,879,096 (GRCm39) missense possibly damaging 0.84
R8332:Herc2 UTSW 7 55,796,343 (GRCm39) missense probably damaging 1.00
R8432:Herc2 UTSW 7 55,804,860 (GRCm39) missense probably benign 0.14
R8516:Herc2 UTSW 7 55,856,318 (GRCm39) missense probably benign 0.05
R8676:Herc2 UTSW 7 55,838,361 (GRCm39) missense probably damaging 1.00
R8738:Herc2 UTSW 7 55,798,402 (GRCm39) missense possibly damaging 0.78
R8742:Herc2 UTSW 7 55,744,143 (GRCm39) missense probably benign 0.12
R8796:Herc2 UTSW 7 55,785,123 (GRCm39) missense probably benign 0.01
R8825:Herc2 UTSW 7 55,700,626 (GRCm39) start codon destroyed probably null 0.01
R8826:Herc2 UTSW 7 55,756,144 (GRCm39) missense probably benign 0.12
R8842:Herc2 UTSW 7 55,738,059 (GRCm39) missense probably damaging 0.99
R9103:Herc2 UTSW 7 55,784,803 (GRCm39) missense possibly damaging 0.47
R9124:Herc2 UTSW 7 55,834,056 (GRCm39) missense probably damaging 1.00
R9134:Herc2 UTSW 7 55,832,177 (GRCm39) missense probably damaging 0.99
R9168:Herc2 UTSW 7 55,802,208 (GRCm39) missense probably damaging 0.99
R9173:Herc2 UTSW 7 55,856,350 (GRCm39) missense probably damaging 0.97
R9238:Herc2 UTSW 7 55,813,508 (GRCm39) missense probably damaging 0.98
R9249:Herc2 UTSW 7 55,762,890 (GRCm39) missense probably damaging 1.00
R9344:Herc2 UTSW 7 55,772,112 (GRCm39) missense probably benign 0.07
R9432:Herc2 UTSW 7 55,780,932 (GRCm39) missense probably damaging 1.00
R9472:Herc2 UTSW 7 55,813,843 (GRCm39) missense probably damaging 1.00
R9513:Herc2 UTSW 7 55,762,848 (GRCm39) missense probably damaging 1.00
R9579:Herc2 UTSW 7 55,758,500 (GRCm39) missense probably damaging 0.99
R9596:Herc2 UTSW 7 55,834,595 (GRCm39) missense
R9664:Herc2 UTSW 7 55,820,338 (GRCm39) missense possibly damaging 0.90
R9760:Herc2 UTSW 7 55,813,659 (GRCm39) critical splice donor site probably null
R9781:Herc2 UTSW 7 55,750,096 (GRCm39) missense possibly damaging 0.53
RF024:Herc2 UTSW 7 55,876,273 (GRCm39) missense probably damaging 1.00
X0011:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
X0023:Herc2 UTSW 7 55,740,666 (GRCm39) missense possibly damaging 0.73
X0057:Herc2 UTSW 7 55,879,438 (GRCm39) missense probably benign 0.04
X0064:Herc2 UTSW 7 55,841,006 (GRCm39) missense probably benign
X0064:Herc2 UTSW 7 55,840,959 (GRCm39) missense probably benign 0.01
Z1088:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
Z1088:Herc2 UTSW 7 55,737,089 (GRCm39) missense probably benign 0.00
Z1088:Herc2 UTSW 7 55,876,337 (GRCm39) missense probably damaging 1.00
Z1088:Herc2 UTSW 7 55,865,180 (GRCm39) missense probably damaging 1.00
Z1088:Herc2 UTSW 7 55,865,129 (GRCm39) missense possibly damaging 0.86
Z1176:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
Z1176:Herc2 UTSW 7 55,747,281 (GRCm39) missense possibly damaging 0.48
Z1176:Herc2 UTSW 7 55,782,246 (GRCm39) missense probably damaging 1.00
Z1177:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
Z1177:Herc2 UTSW 7 55,771,337 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCTAATCCTGCCTATTAACCAACTTG -3'
(R):5'- TGATGAGGCCATTCCACTGG -3'

Sequencing Primer
(F):5'- CTCTGATCAGATCTTAGCTG -3'
(R):5'- ATTCCACTGGGTCAGGGAG -3'
Posted On 2019-11-12