Incidental Mutation 'R7665:Vmn2r67'
ID 591859
Institutional Source Beutler Lab
Gene Symbol Vmn2r67
Ensembl Gene ENSMUSG00000095664
Gene Name vomeronasal 2, receptor 67
Synonyms EG620672
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 84785448-84805110 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 84801196 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 247 (K247*)
Ref Sequence ENSEMBL: ENSMUSP00000126007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168730]
AlphaFold K7N6T2
Predicted Effect probably null
Transcript: ENSMUST00000168730
AA Change: K247*
SMART Domains Protein: ENSMUSP00000126007
Gene: ENSMUSG00000095664
AA Change: K247*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 464 2.1e-31 PFAM
Pfam:NCD3G 507 559 4.8e-19 PFAM
Pfam:7tm_3 590 827 1.4e-53 PFAM
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Vmn2r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Vmn2r67 APN 7 84,801,138 (GRCm39) missense probably damaging 1.00
IGL01346:Vmn2r67 APN 7 84,786,127 (GRCm39) missense probably damaging 1.00
IGL01373:Vmn2r67 APN 7 84,785,834 (GRCm39) missense probably benign 0.10
IGL01674:Vmn2r67 APN 7 84,785,651 (GRCm39) missense probably damaging 1.00
IGL01978:Vmn2r67 APN 7 84,800,649 (GRCm39) critical splice donor site probably null
IGL02013:Vmn2r67 APN 7 84,800,863 (GRCm39) missense probably benign 0.09
IGL02115:Vmn2r67 APN 7 84,800,787 (GRCm39) missense probably damaging 0.99
IGL02250:Vmn2r67 APN 7 84,805,008 (GRCm39) missense probably benign
IGL02252:Vmn2r67 APN 7 84,805,008 (GRCm39) missense probably benign
IGL02328:Vmn2r67 APN 7 84,799,898 (GRCm39) missense probably benign 0.41
IGL02740:Vmn2r67 APN 7 84,785,818 (GRCm39) missense probably damaging 1.00
IGL02940:Vmn2r67 APN 7 84,785,951 (GRCm39) missense probably benign 0.07
IGL03237:Vmn2r67 APN 7 84,799,118 (GRCm39) missense probably damaging 1.00
R0512:Vmn2r67 UTSW 7 84,799,900 (GRCm39) missense probably damaging 1.00
R1029:Vmn2r67 UTSW 7 84,785,974 (GRCm39) missense probably damaging 1.00
R1193:Vmn2r67 UTSW 7 84,800,653 (GRCm39) missense probably damaging 0.98
R1282:Vmn2r67 UTSW 7 84,785,932 (GRCm39) missense probably benign
R1416:Vmn2r67 UTSW 7 84,800,824 (GRCm39) missense probably benign 0.06
R1429:Vmn2r67 UTSW 7 84,802,031 (GRCm39) missense possibly damaging 0.65
R1462:Vmn2r67 UTSW 7 84,805,046 (GRCm39) missense probably benign 0.00
R1462:Vmn2r67 UTSW 7 84,805,046 (GRCm39) missense probably benign 0.00
R1970:Vmn2r67 UTSW 7 84,801,013 (GRCm39) missense probably benign
R2229:Vmn2r67 UTSW 7 84,801,250 (GRCm39) missense probably benign 0.21
R2246:Vmn2r67 UTSW 7 84,785,764 (GRCm39) missense probably damaging 1.00
R2262:Vmn2r67 UTSW 7 84,786,182 (GRCm39) missense probably damaging 0.96
R2398:Vmn2r67 UTSW 7 84,785,921 (GRCm39) missense probably damaging 1.00
R4249:Vmn2r67 UTSW 7 84,799,722 (GRCm39) splice site probably null
R4666:Vmn2r67 UTSW 7 84,799,831 (GRCm39) missense probably benign
R4669:Vmn2r67 UTSW 7 84,799,732 (GRCm39) missense probably benign 0.11
R4966:Vmn2r67 UTSW 7 84,785,593 (GRCm39) missense probably damaging 1.00
R5264:Vmn2r67 UTSW 7 84,801,453 (GRCm39) missense probably damaging 1.00
R5296:Vmn2r67 UTSW 7 84,786,230 (GRCm39) missense probably damaging 1.00
R5327:Vmn2r67 UTSW 7 84,785,698 (GRCm39) missense probably damaging 1.00
R5401:Vmn2r67 UTSW 7 84,785,765 (GRCm39) missense probably damaging 1.00
R5510:Vmn2r67 UTSW 7 84,801,023 (GRCm39) missense probably benign 0.39
R5574:Vmn2r67 UTSW 7 84,801,099 (GRCm39) missense probably benign 0.00
R5643:Vmn2r67 UTSW 7 84,799,151 (GRCm39) nonsense probably null
R5914:Vmn2r67 UTSW 7 84,801,044 (GRCm39) missense probably damaging 1.00
R6248:Vmn2r67 UTSW 7 84,799,768 (GRCm39) missense probably damaging 0.99
R6291:Vmn2r67 UTSW 7 84,799,142 (GRCm39) missense possibly damaging 0.88
R6309:Vmn2r67 UTSW 7 84,801,124 (GRCm39) missense probably benign
R6442:Vmn2r67 UTSW 7 84,805,046 (GRCm39) missense possibly damaging 0.82
R6665:Vmn2r67 UTSW 7 84,785,900 (GRCm39) missense probably benign 0.07
R6701:Vmn2r67 UTSW 7 84,802,023 (GRCm39) missense probably damaging 1.00
R6848:Vmn2r67 UTSW 7 84,801,840 (GRCm39) missense probably benign 0.00
R6852:Vmn2r67 UTSW 7 84,801,361 (GRCm39) missense probably damaging 0.99
R6991:Vmn2r67 UTSW 7 84,804,953 (GRCm39) missense possibly damaging 0.55
R7143:Vmn2r67 UTSW 7 84,801,846 (GRCm39) missense probably benign
R7197:Vmn2r67 UTSW 7 84,785,774 (GRCm39) missense possibly damaging 0.77
R7393:Vmn2r67 UTSW 7 84,805,086 (GRCm39) missense probably null 0.87
R7420:Vmn2r67 UTSW 7 84,785,944 (GRCm39) missense possibly damaging 0.52
R7622:Vmn2r67 UTSW 7 84,785,662 (GRCm39) missense probably damaging 1.00
R7664:Vmn2r67 UTSW 7 84,805,019 (GRCm39) missense probably benign 0.21
R7896:Vmn2r67 UTSW 7 84,785,920 (GRCm39) missense probably damaging 1.00
R7913:Vmn2r67 UTSW 7 84,801,036 (GRCm39) missense possibly damaging 0.87
R8026:Vmn2r67 UTSW 7 84,785,924 (GRCm39) missense probably damaging 1.00
R8114:Vmn2r67 UTSW 7 84,805,097 (GRCm39) missense probably benign 0.01
R8317:Vmn2r67 UTSW 7 84,785,834 (GRCm39) missense probably benign 0.10
R8363:Vmn2r67 UTSW 7 84,804,969 (GRCm39) missense probably benign 0.00
R8421:Vmn2r67 UTSW 7 84,785,893 (GRCm39) missense probably damaging 0.98
R8444:Vmn2r67 UTSW 7 84,785,854 (GRCm39) missense probably benign 0.01
R8751:Vmn2r67 UTSW 7 84,801,450 (GRCm39) missense probably benign 0.01
R8810:Vmn2r67 UTSW 7 84,786,346 (GRCm39) missense probably damaging 1.00
R8811:Vmn2r67 UTSW 7 84,799,895 (GRCm39) missense probably damaging 0.98
R9215:Vmn2r67 UTSW 7 84,802,008 (GRCm39) missense probably benign 0.00
R9342:Vmn2r67 UTSW 7 84,785,788 (GRCm39) missense probably benign 0.00
R9433:Vmn2r67 UTSW 7 84,804,917 (GRCm39) missense possibly damaging 0.60
R9453:Vmn2r67 UTSW 7 84,800,697 (GRCm39) missense probably benign 0.32
R9471:Vmn2r67 UTSW 7 84,799,723 (GRCm39) critical splice donor site probably null
R9526:Vmn2r67 UTSW 7 84,785,834 (GRCm39) missense probably benign 0.10
R9538:Vmn2r67 UTSW 7 84,801,327 (GRCm39) missense
R9544:Vmn2r67 UTSW 7 84,786,317 (GRCm39) missense possibly damaging 0.53
R9574:Vmn2r67 UTSW 7 84,786,017 (GRCm39) missense probably benign 0.00
R9599:Vmn2r67 UTSW 7 84,804,941 (GRCm39) missense probably damaging 0.96
R9768:Vmn2r67 UTSW 7 84,802,037 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACCAGATAGTTCAGGTTTCTGG -3'
(R):5'- TAGCCATGGTGTCCCTAATGG -3'

Sequencing Primer
(F):5'- AGCATGAAATCTCCTAGTTTTGTG -3'
(R):5'- CCCTAATGGTTCATTTCAGATGG -3'
Posted On 2019-11-12