Incidental Mutation 'R7665:Or2ag2'
ID 591861
Institutional Source Beutler Lab
Gene Symbol Or2ag2
Ensembl Gene ENSMUSG00000109354
Gene Name olfactory receptor family 2 subfamily AG member 2
Synonyms MOR283-11, GA_x6K02T2PBJ9-9271198-9270248, Olfr706
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.289) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 106485072-106486022 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106485880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 48 (V48D)
Ref Sequence ENSEMBL: ENSMUSP00000150075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088687] [ENSMUST00000208759] [ENSMUST00000209025] [ENSMUST00000210644] [ENSMUST00000213251] [ENSMUST00000213918] [ENSMUST00000214112]
AlphaFold Q9EPF8
Predicted Effect probably benign
Transcript: ENSMUST00000088687
SMART Domains Protein: ENSMUSP00000086062
Gene: ENSMUSG00000069390

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 303 9.1e-9 PFAM
Pfam:7tm_1 41 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208759
Predicted Effect possibly damaging
Transcript: ENSMUST00000209025
AA Change: V48D

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000210644
Predicted Effect probably benign
Transcript: ENSMUST00000213251
Predicted Effect possibly damaging
Transcript: ENSMUST00000213918
AA Change: V48D

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000214112
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Or2ag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02311:Or2ag2 APN 7 106,485,101 (GRCm39) missense probably benign 0.00
IGL03093:Or2ag2 APN 7 106,485,410 (GRCm39) missense probably benign 0.02
IGL03354:Or2ag2 APN 7 106,485,307 (GRCm39) missense probably benign 0.07
R0334:Or2ag2 UTSW 7 106,485,622 (GRCm39) missense probably benign 0.00
R1577:Or2ag2 UTSW 7 106,485,217 (GRCm39) missense probably benign 0.03
R4083:Or2ag2 UTSW 7 106,485,851 (GRCm39) missense probably damaging 0.97
R4399:Or2ag2 UTSW 7 106,485,660 (GRCm39) missense probably damaging 1.00
R4421:Or2ag2 UTSW 7 106,485,660 (GRCm39) missense probably damaging 1.00
R5202:Or2ag2 UTSW 7 106,485,803 (GRCm39) missense possibly damaging 0.90
R6031:Or2ag2 UTSW 7 106,485,134 (GRCm39) missense possibly damaging 0.93
R6031:Or2ag2 UTSW 7 106,485,134 (GRCm39) missense possibly damaging 0.93
R6375:Or2ag2 UTSW 7 106,485,221 (GRCm39) missense probably benign
R6475:Or2ag2 UTSW 7 106,485,604 (GRCm39) missense probably benign 0.00
R7742:Or2ag2 UTSW 7 106,485,829 (GRCm39) missense probably damaging 1.00
R7956:Or2ag2 UTSW 7 106,485,178 (GRCm39) missense possibly damaging 0.88
R8678:Or2ag2 UTSW 7 106,485,280 (GRCm39) missense probably damaging 1.00
Z1088:Or2ag2 UTSW 7 106,485,503 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGCCACATACCTGTCATAG -3'
(R):5'- TTTCTAGGCAATCAAAGATACCACC -3'

Sequencing Primer
(F):5'- TGCACTGCCTAGCATCAATG -3'
(R):5'- CACCCAGAATGGAGCTCTG -3'
Posted On 2019-11-12