Incidental Mutation 'R7665:Neo1'
ID 591867
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Name neogenin
Synonyms 2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 58781970-58943724 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58833078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 556 (S556P)
Ref Sequence ENSEMBL: ENSMUSP00000063656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068664
AA Change: S556P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: S556P

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214547
AA Change: S556P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216964
AA Change: S283P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.9138 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58,829,202 (GRCm39) splice site probably benign
IGL00885:Neo1 APN 9 58,795,746 (GRCm39) missense probably damaging 1.00
IGL01103:Neo1 APN 9 58,788,082 (GRCm39) missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58,814,368 (GRCm39) missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58,824,336 (GRCm39) missense probably damaging 0.96
IGL02327:Neo1 APN 9 58,810,371 (GRCm39) missense probably benign 0.08
IGL02392:Neo1 APN 9 58,833,094 (GRCm39) missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58,801,150 (GRCm39) splice site probably benign
IGL03057:Neo1 APN 9 58,785,342 (GRCm39) missense probably damaging 1.00
IGL03091:Neo1 APN 9 58,885,951 (GRCm39) missense probably damaging 0.98
IGL03193:Neo1 APN 9 58,815,767 (GRCm39) missense probably damaging 1.00
R0097:Neo1 UTSW 9 58,882,021 (GRCm38) intron probably benign
R0419:Neo1 UTSW 9 58,897,463 (GRCm39) splice site probably benign
R0571:Neo1 UTSW 9 58,893,069 (GRCm39) missense probably benign
R0646:Neo1 UTSW 9 58,838,317 (GRCm39) missense probably damaging 1.00
R0736:Neo1 UTSW 9 58,824,364 (GRCm39) missense possibly damaging 0.78
R0739:Neo1 UTSW 9 58,829,160 (GRCm39) missense probably benign 0.22
R1636:Neo1 UTSW 9 58,820,560 (GRCm39) missense probably damaging 1.00
R1694:Neo1 UTSW 9 58,787,886 (GRCm39) missense probably damaging 1.00
R1827:Neo1 UTSW 9 58,824,314 (GRCm39) nonsense probably null
R1927:Neo1 UTSW 9 58,897,668 (GRCm39) missense probably benign 0.12
R2354:Neo1 UTSW 9 58,892,917 (GRCm39) missense probably benign
R2365:Neo1 UTSW 9 58,863,286 (GRCm39) missense probably benign
R3156:Neo1 UTSW 9 58,796,262 (GRCm39) splice site probably null
R3552:Neo1 UTSW 9 58,801,161 (GRCm39) missense probably damaging 1.00
R3829:Neo1 UTSW 9 58,820,452 (GRCm39) missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58,784,582 (GRCm39) missense probably damaging 0.99
R4613:Neo1 UTSW 9 58,796,324 (GRCm39) missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58,897,554 (GRCm39) missense probably damaging 1.00
R5046:Neo1 UTSW 9 58,801,194 (GRCm39) missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58,897,554 (GRCm39) missense probably damaging 1.00
R5323:Neo1 UTSW 9 58,813,931 (GRCm39) critical splice donor site probably null
R5394:Neo1 UTSW 9 58,897,517 (GRCm39) missense probably benign 0.10
R5470:Neo1 UTSW 9 58,838,350 (GRCm39) missense probably damaging 1.00
R5473:Neo1 UTSW 9 58,788,126 (GRCm39) missense possibly damaging 0.88
R5500:Neo1 UTSW 9 58,824,337 (GRCm39) missense possibly damaging 0.94
R5503:Neo1 UTSW 9 58,892,933 (GRCm39) missense possibly damaging 0.67
R6122:Neo1 UTSW 9 58,824,291 (GRCm39) missense probably benign
R6191:Neo1 UTSW 9 58,796,312 (GRCm39) missense probably damaging 1.00
R6431:Neo1 UTSW 9 58,814,354 (GRCm39) missense probably benign 0.27
R6560:Neo1 UTSW 9 58,787,884 (GRCm39) missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58,829,132 (GRCm39) missense probably benign 0.14
R6772:Neo1 UTSW 9 58,810,259 (GRCm39) missense probably damaging 1.00
R6912:Neo1 UTSW 9 58,824,335 (GRCm39) missense probably benign 0.00
R7061:Neo1 UTSW 9 58,897,724 (GRCm39) missense possibly damaging 0.95
R7145:Neo1 UTSW 9 58,796,462 (GRCm39) missense probably damaging 1.00
R7156:Neo1 UTSW 9 58,810,206 (GRCm39) missense probably damaging 1.00
R7485:Neo1 UTSW 9 58,791,826 (GRCm39) missense probably benign 0.04
R7519:Neo1 UTSW 9 58,785,348 (GRCm39) missense probably benign 0.13
R7615:Neo1 UTSW 9 58,791,786 (GRCm39) missense probably benign 0.07
R7695:Neo1 UTSW 9 58,810,212 (GRCm39) missense possibly damaging 0.81
R7753:Neo1 UTSW 9 58,863,288 (GRCm39) missense probably benign 0.00
R7807:Neo1 UTSW 9 58,897,777 (GRCm39) missense probably benign 0.01
R7915:Neo1 UTSW 9 58,838,264 (GRCm39) missense probably benign 0.42
R7973:Neo1 UTSW 9 58,897,476 (GRCm39) missense probably damaging 1.00
R8356:Neo1 UTSW 9 58,785,402 (GRCm39) missense probably damaging 1.00
R8505:Neo1 UTSW 9 58,820,566 (GRCm39) missense probably benign 0.02
R8700:Neo1 UTSW 9 58,825,913 (GRCm39) missense probably benign 0.28
R8798:Neo1 UTSW 9 58,820,449 (GRCm39) missense probably damaging 1.00
R8952:Neo1 UTSW 9 58,897,545 (GRCm39) missense probably benign 0.01
R9779:Neo1 UTSW 9 58,886,009 (GRCm39) nonsense probably null
R9784:Neo1 UTSW 9 58,889,503 (GRCm39) missense probably benign
R9789:Neo1 UTSW 9 58,801,307 (GRCm39) critical splice acceptor site probably null
X0063:Neo1 UTSW 9 58,897,581 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATACACAGGCTGTCCCTTTAC -3'
(R):5'- GCCTGGTAACACTCAGTTTCAC -3'

Sequencing Primer
(F):5'- ACAGGCTGTCCCTTTACTTGCTATG -3'
(R):5'- GTGAAACTATCCAGAGCTCTGCTG -3'
Posted On 2019-11-12