Incidental Mutation 'R7665:Neo1'
ID 591867
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Name neogenin
Synonyms 2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 58874687-59036441 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58925795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 556 (S556P)
Ref Sequence ENSEMBL: ENSMUSP00000063656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068664
AA Change: S556P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: S556P

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214547
AA Change: S556P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216964
AA Change: S283P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.9138 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,874,323 probably null Het
A830018L16Rik T C 1: 11,972,099 S448P probably damaging Het
Abca4 C T 3: 122,044,490 probably benign Het
Ackr2 A G 9: 121,909,308 M250V probably benign Het
Actn4 A G 7: 28,916,207 I147T probably damaging Het
Adgrv1 C T 13: 81,499,142 S3093N probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Brwd1 G A 16: 96,041,343 T798M probably benign Het
Cdk13 G A 13: 17,772,553 T540I possibly damaging Het
Cdkn1c A G 7: 143,460,634 V25A possibly damaging Het
Col2a1 T C 15: 97,976,700 E1420G unknown Het
Dbf4 G A 5: 8,397,867 P448S probably damaging Het
Dnajb7 T C 15: 81,407,419 N239S probably benign Het
Dnttip1 A G 2: 164,754,141 D102G probably damaging Het
Dpp8 T A 9: 65,078,718 V830D probably damaging Het
Eef1g T C 19: 8,968,289 V29A probably benign Het
Enpp2 T A 15: 54,839,394 Y906F probably damaging Het
Epb41l4a A G 18: 34,006,016 L23P possibly damaging Het
Epp13 G A 7: 6,269,892 probably null Het
Exoc1 T A 5: 76,543,573 M248K probably benign Het
Fam83b T C 9: 76,490,875 Y982C probably damaging Het
Fat4 C T 3: 38,889,178 A740V probably benign Het
Fsip2 T A 2: 82,981,805 S2823T probably benign Het
Gckr T C 5: 31,297,555 Het
Gpr150 A T 13: 76,055,974 V284E probably damaging Het
Grtp1 T G 8: 13,177,103 I344L probably benign Het
Heatr5a T A 12: 51,961,530 N10I probably damaging Het
Herc2 C A 7: 56,153,155 L2109I probably damaging Het
Hs1bp3 T A 12: 8,317,935 D61E probably damaging Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Itfg1 A G 8: 85,764,350 F317L probably benign Het
Itsn1 T C 16: 91,841,603 I764T unknown Het
Med8 A C 4: 118,411,656 probably null Het
Mpeg1 C A 19: 12,463,094 P639T probably damaging Het
Nedd9 A G 13: 41,316,309 L456P probably benign Het
Nphp3 T A 9: 104,005,393 probably null Het
Nup205 T C 6: 35,177,620 V53A possibly damaging Het
Nvl A T 1: 181,134,944 S154T probably benign Het
Olfr239 G T 17: 33,199,629 G194* probably null Het
Olfr391-ps A T 11: 73,798,961 N265K probably benign Het
Olfr615 A T 7: 103,561,316 I280F probably benign Het
Olfr706 A T 7: 106,886,673 V48D possibly damaging Het
Olfr827 T A 10: 130,211,261 probably null Het
Olfr92 A G 17: 37,111,391 M197T probably benign Het
Parvg T C 15: 84,337,801 I243T probably damaging Het
Paxip1 T A 5: 27,765,738 M538L unknown Het
Pgghg G T 7: 140,945,469 D428Y probably damaging Het
Pik3cd C T 4: 149,654,050 V777M possibly damaging Het
Plcl2 A C 17: 50,607,157 K398T probably benign Het
Plxna1 A T 6: 89,324,538 probably null Het
Rbbp6 T C 7: 122,994,686 Y514H possibly damaging Het
Rbbp6 T A 7: 122,990,032 probably null Het
Scin T A 12: 40,069,415 N538I probably damaging Het
Sdcbp A G 4: 6,385,144 D121G probably benign Het
Sgk1 T C 10: 21,996,662 I311T probably damaging Het
Shq1 A C 6: 100,573,756 L407W probably damaging Het
Sipa1 A T 19: 5,651,671 S979T probably benign Het
Slc25a37 G T 14: 69,249,579 T85K probably benign Het
Soga3 T A 10: 29,196,397 Y562N probably damaging Het
Spag9 A T 11: 94,013,654 Q112L probably damaging Het
Spg11 A T 2: 122,066,267 V1686E probably damaging Het
Stap2 A G 17: 55,997,909 V291A probably benign Het
Tnk2 C T 16: 32,680,526 R886C probably damaging Het
Tnrc6c T A 11: 117,720,951 D138E possibly damaging Het
Unc13c A G 9: 73,680,474 S1426P probably benign Het
Vav1 G A 17: 57,297,086 V163M probably damaging Het
Vmn2r67 T A 7: 85,151,988 K247* probably null Het
Zc2hc1c T C 12: 85,296,562 V491A possibly damaging Het
Zfp51 A G 17: 21,463,581 T153A probably benign Het
Zyx A G 6: 42,356,162 E374G probably damaging Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58921919 splice site probably benign
IGL00885:Neo1 APN 9 58888463 missense probably damaging 1.00
IGL01103:Neo1 APN 9 58880799 missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58907085 missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58917053 missense probably damaging 0.96
IGL02327:Neo1 APN 9 58903088 missense probably benign 0.08
IGL02392:Neo1 APN 9 58925811 missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58893867 splice site probably benign
IGL03057:Neo1 APN 9 58878059 missense probably damaging 1.00
IGL03091:Neo1 APN 9 58978668 missense probably damaging 0.98
IGL03193:Neo1 APN 9 58908484 missense probably damaging 1.00
R0097:Neo1 UTSW 9 58882021 intron probably benign
R0419:Neo1 UTSW 9 58990180 splice site probably benign
R0571:Neo1 UTSW 9 58985786 missense probably benign
R0646:Neo1 UTSW 9 58931034 missense probably damaging 1.00
R0736:Neo1 UTSW 9 58917081 missense possibly damaging 0.78
R0739:Neo1 UTSW 9 58921877 missense probably benign 0.22
R1636:Neo1 UTSW 9 58913277 missense probably damaging 1.00
R1694:Neo1 UTSW 9 58880603 missense probably damaging 1.00
R1827:Neo1 UTSW 9 58917031 nonsense probably null
R1927:Neo1 UTSW 9 58990385 missense probably benign 0.12
R2354:Neo1 UTSW 9 58985634 missense probably benign
R2365:Neo1 UTSW 9 58956003 missense probably benign
R3156:Neo1 UTSW 9 58888979 splice site probably null
R3552:Neo1 UTSW 9 58893878 missense probably damaging 1.00
R3829:Neo1 UTSW 9 58913169 missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58877299 missense probably damaging 0.99
R4613:Neo1 UTSW 9 58889041 missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5046:Neo1 UTSW 9 58893911 missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5323:Neo1 UTSW 9 58906648 critical splice donor site probably null
R5394:Neo1 UTSW 9 58990234 missense probably benign 0.10
R5470:Neo1 UTSW 9 58931067 missense probably damaging 1.00
R5473:Neo1 UTSW 9 58880843 missense possibly damaging 0.88
R5500:Neo1 UTSW 9 58917054 missense possibly damaging 0.94
R5503:Neo1 UTSW 9 58985650 missense possibly damaging 0.67
R6122:Neo1 UTSW 9 58917008 missense probably benign
R6191:Neo1 UTSW 9 58889029 missense probably damaging 1.00
R6431:Neo1 UTSW 9 58907071 missense probably benign 0.27
R6560:Neo1 UTSW 9 58880601 missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58921849 missense probably benign 0.14
R6772:Neo1 UTSW 9 58902976 missense probably damaging 1.00
R6912:Neo1 UTSW 9 58917052 missense probably benign 0.00
R7061:Neo1 UTSW 9 58990441 missense possibly damaging 0.95
R7145:Neo1 UTSW 9 58889179 missense probably damaging 1.00
R7156:Neo1 UTSW 9 58902923 missense probably damaging 1.00
R7485:Neo1 UTSW 9 58884543 missense probably benign 0.04
R7519:Neo1 UTSW 9 58878065 missense probably benign 0.13
R7615:Neo1 UTSW 9 58884503 missense probably benign 0.07
R7695:Neo1 UTSW 9 58902929 missense possibly damaging 0.81
R7753:Neo1 UTSW 9 58956005 missense probably benign 0.00
R7807:Neo1 UTSW 9 58990494 missense probably benign 0.01
R7915:Neo1 UTSW 9 58930981 missense probably benign 0.42
R7973:Neo1 UTSW 9 58990193 missense probably damaging 1.00
R8356:Neo1 UTSW 9 58878119 missense probably damaging 1.00
R8505:Neo1 UTSW 9 58913283 missense probably benign 0.02
R8700:Neo1 UTSW 9 58918630 missense probably benign 0.28
R8798:Neo1 UTSW 9 58913166 missense probably damaging 1.00
R8952:Neo1 UTSW 9 58990262 missense probably benign 0.01
R9779:Neo1 UTSW 9 58978726 nonsense probably null
R9784:Neo1 UTSW 9 58982220 missense probably benign
R9789:Neo1 UTSW 9 58894024 critical splice acceptor site probably null
X0063:Neo1 UTSW 9 58990298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATACACAGGCTGTCCCTTTAC -3'
(R):5'- GCCTGGTAACACTCAGTTTCAC -3'

Sequencing Primer
(F):5'- ACAGGCTGTCCCTTTACTTGCTATG -3'
(R):5'- GTGAAACTATCCAGAGCTCTGCTG -3'
Posted On 2019-11-12