Mutagenetix > Incidental Mutation

Incidental Mutation 'R7665:Spag9'

591876

Institutional Source

Beutler Lab

Gene Symbol

Spag9

Ensembl Gene

ENSMUSG00000020859

Gene Name

sperm associated antigen 9

Synonyms

syd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik

MMRRC Submission

Accession Numbers

Genbank: NM_027569; MGI: 1918084

Essential gene?

Possibly essential (E-score: 0.687) question?

Stock #

R7665 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93996091-94126085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94013654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 112 (Q112L)

Ref Sequence

ENSEMBL: ENSMUSP00000042271 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041956]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041956
AA Change: Q112L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: Q112L

Domain	Start	End	E-Value	Type
Pfam:Jnk-SapK_ap_N	24	179	2e-61	PFAM
Pfam:JIP_LZII	390	460	5.3e-32	PFAM
coiled coil region	710	744	N/A	INTRINSIC
low complexity region	873	889	N/A	INTRINSIC
SCOP:d1kb0a2	961	1107	1e-5	SMART
Blast:WD40	1062	1102	1e-17	BLAST
low complexity region	1270	1288	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	A	G	5: 114,874,323		probably null	Het
A830018L16Rik	T	C	1: 11,972,099	S448P	probably damaging	Het
Abca4	C	T	3: 122,044,490		probably benign	Het
Ackr2	A	G	9: 121,909,308	M250V	probably benign	Het
Actn4	A	G	7: 28,916,207	I147T	probably damaging	Het
Adgrv1	C	T	13: 81,499,142	S3093N	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Brwd1	G	A	16: 96,041,343	T798M	probably benign	Het
Cdk13	G	A	13: 17,772,553	T540I	possibly damaging	Het
Cdkn1c	A	G	7: 143,460,634	V25A	possibly damaging	Het
Col2a1	T	C	15: 97,976,700	E1420G	unknown	Het
Dbf4	G	A	5: 8,397,867	P448S	probably damaging	Het
Dnajb7	T	C	15: 81,407,419	N239S	probably benign	Het
Dnttip1	A	G	2: 164,754,141	D102G	probably damaging	Het
Dpp8	T	A	9: 65,078,718	V830D	probably damaging	Het
Eef1g	T	C	19: 8,968,289	V29A	probably benign	Het
Enpp2	T	A	15: 54,839,394	Y906F	probably damaging	Het
Epb41l4a	A	G	18: 34,006,016	L23P	possibly damaging	Het
Epp13	G	A	7: 6,269,892		probably null	Het
Exoc1	T	A	5: 76,543,573	M248K	probably benign	Het
Fam83b	T	C	9: 76,490,875	Y982C	probably damaging	Het
Fat4	C	T	3: 38,889,178	A740V	probably benign	Het
Fsip2	T	A	2: 82,981,805	S2823T	probably benign	Het
Gckr	T	C	5: 31,297,555			Het
Gpr150	A	T	13: 76,055,974	V284E	probably damaging	Het
Grtp1	T	G	8: 13,177,103	I344L	probably benign	Het
Heatr5a	T	A	12: 51,961,530	N10I	probably damaging	Het
Herc2	C	A	7: 56,153,155	L2109I	probably damaging	Het
Hs1bp3	T	A	12: 8,317,935	D61E	probably damaging	Het
Ifit1bl1	T	A	19: 34,594,883	Y58F	probably benign	Het
Itfg1	A	G	8: 85,764,350	F317L	probably benign	Het
Itsn1	T	C	16: 91,841,603	I764T	unknown	Het
Med8	A	C	4: 118,411,656		probably null	Het
Mpeg1	C	A	19: 12,463,094	P639T	probably damaging	Het
Nedd9	A	G	13: 41,316,309	L456P	probably benign	Het
Neo1	A	G	9: 58,925,795	S556P	probably damaging	Het
Nphp3	T	A	9: 104,005,393		probably null	Het
Nup205	T	C	6: 35,177,620	V53A	possibly damaging	Het
Nvl	A	T	1: 181,134,944	S154T	probably benign	Het
Olfr239	G	T	17: 33,199,629	G194*	probably null	Het
Olfr391-ps	A	T	11: 73,798,961	N265K	probably benign	Het
Olfr615	A	T	7: 103,561,316	I280F	probably benign	Het
Olfr706	A	T	7: 106,886,673	V48D	possibly damaging	Het
Olfr827	T	A	10: 130,211,261		probably null	Het
Olfr92	A	G	17: 37,111,391	M197T	probably benign	Het
Parvg	T	C	15: 84,337,801	I243T	probably damaging	Het
Paxip1	T	A	5: 27,765,738	M538L	unknown	Het
Pgghg	G	T	7: 140,945,469	D428Y	probably damaging	Het
Pik3cd	C	T	4: 149,654,050	V777M	possibly damaging	Het
Plcl2	A	C	17: 50,607,157	K398T	probably benign	Het
Plxna1	A	T	6: 89,324,538		probably null	Het
Rbbp6	T	C	7: 122,994,686	Y514H	possibly damaging	Het
Rbbp6	T	A	7: 122,990,032		probably null	Het
Scin	T	A	12: 40,069,415	N538I	probably damaging	Het
Sdcbp	A	G	4: 6,385,144	D121G	probably benign	Het
Sgk1	T	C	10: 21,996,662	I311T	probably damaging	Het
Shq1	A	C	6: 100,573,756	L407W	probably damaging	Het
Sipa1	A	T	19: 5,651,671	S979T	probably benign	Het
Slc25a37	G	T	14: 69,249,579	T85K	probably benign	Het
Soga3	T	A	10: 29,196,397	Y562N	probably damaging	Het
Spg11	A	T	2: 122,066,267	V1686E	probably damaging	Het
Stap2	A	G	17: 55,997,909	V291A	probably benign	Het
Tnk2	C	T	16: 32,680,526	R886C	probably damaging	Het
Tnrc6c	T	A	11: 117,720,951	D138E	possibly damaging	Het
Unc13c	A	G	9: 73,680,474	S1426P	probably benign	Het
Vav1	G	A	17: 57,297,086	V163M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,988	K247*	probably null	Het
Zc2hc1c	T	C	12: 85,296,562	V491A	possibly damaging	Het
Zfp51	A	G	17: 21,463,581	T153A	probably benign	Het
Zyx	A	G	6: 42,356,162	E374G	probably damaging	Het

Other mutations in Spag9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Spag9	APN	11	94097866	missense	probably benign	0.02
IGL01776:Spag9	APN	11	94116727	splice site	probably benign
IGL02095:Spag9	APN	11	94108582	missense	probably damaging	1.00
IGL02307:Spag9	APN	11	94102160	critical splice donor site	probably null
IGL02417:Spag9	APN	11	94116741	missense	probably benign	0.27
IGL02480:Spag9	APN	11	94108587	nonsense	probably null
IGL02864:Spag9	APN	11	94106661	missense	probably damaging	1.00
IGL02976:Spag9	APN	11	94083953	missense	probably benign	0.30
IGL02979:Spag9	APN	11	94097364	missense	probably benign
IGL03349:Spag9	APN	11	94093509	missense	possibly damaging	0.51
dazzle	UTSW	11	94093624	nonsense	probably null
R0128:Spag9	UTSW	11	94093539	missense	probably damaging	1.00
R0418:Spag9	UTSW	11	94091753	splice site	probably benign
R1463:Spag9	UTSW	11	94116837	missense	probably damaging	1.00
R1593:Spag9	UTSW	11	94097233	missense	probably damaging	1.00
R1605:Spag9	UTSW	11	94048539	missense	probably damaging	0.99
R1649:Spag9	UTSW	11	94108452	splice site	probably null
R1697:Spag9	UTSW	11	93996565	missense	probably benign	0.00
R1952:Spag9	UTSW	11	94097358	missense	possibly damaging	0.77
R2011:Spag9	UTSW	11	94092375	nonsense	probably null
R2012:Spag9	UTSW	11	94092375	nonsense	probably null
R2351:Spag9	UTSW	11	94092900	missense	probably damaging	1.00
R2367:Spag9	UTSW	11	94116757	missense	probably damaging	1.00
R3027:Spag9	UTSW	11	94086377	missense	probably null	1.00
R3766:Spag9	UTSW	11	94060283	intron	probably benign
R3777:Spag9	UTSW	11	94099026	critical splice acceptor site	probably null
R3937:Spag9	UTSW	11	94044417	missense	possibly damaging	0.94
R3937:Spag9	UTSW	11	94044479	missense	possibly damaging	0.92
R4417:Spag9	UTSW	11	94060346	intron	probably benign
R4445:Spag9	UTSW	11	94097253	missense	possibly damaging	0.95
R4711:Spag9	UTSW	11	94114351	critical splice donor site	probably null
R4799:Spag9	UTSW	11	94048516	missense	possibly damaging	0.87
R4799:Spag9	UTSW	11	94048517	missense	probably damaging	0.96
R4816:Spag9	UTSW	11	94048599	intron	probably benign
R4843:Spag9	UTSW	11	94097818	missense	probably damaging	1.00
R5020:Spag9	UTSW	11	94097786	missense	probably benign	0.08
R5119:Spag9	UTSW	11	94122722	missense	probably damaging	1.00
R5298:Spag9	UTSW	11	94100135	missense	probably damaging	1.00
R5304:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5305:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5395:Spag9	UTSW	11	94091751	splice site	probably null
R5636:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5638:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5654:Spag9	UTSW	11	94090712	missense	probably damaging	1.00
R5779:Spag9	UTSW	11	94114253	missense	probably benign	0.20
R5814:Spag9	UTSW	11	94082828	missense	possibly damaging	0.94
R5912:Spag9	UTSW	11	94044425	missense	probably damaging	0.98
R6038:Spag9	UTSW	11	94112092	missense	probably damaging	1.00
R6038:Spag9	UTSW	11	94112092	missense	probably damaging	1.00
R6269:Spag9	UTSW	11	94044507	missense	probably benign	0.05
R6294:Spag9	UTSW	11	94093485	critical splice acceptor site	probably null
R6389:Spag9	UTSW	11	94086311	missense	probably damaging	1.00
R6420:Spag9	UTSW	11	94086302	missense	probably damaging	1.00
R6460:Spag9	UTSW	11	94068975	missense	probably damaging	1.00
R6482:Spag9	UTSW	11	94093502	missense	possibly damaging	0.94
R6860:Spag9	UTSW	11	94081370	missense	probably benign	0.25
R7086:Spag9	UTSW	11	94097864	missense	probably benign
R7179:Spag9	UTSW	11	94089432	splice site	probably null
R7225:Spag9	UTSW	11	94097358	missense	probably damaging	0.98
R7351:Spag9	UTSW	11	94092976	missense	probably benign	0.00
R7366:Spag9	UTSW	11	94108521	missense	possibly damaging	0.56
R7378:Spag9	UTSW	11	94114351	critical splice donor site	probably null
R7401:Spag9	UTSW	11	94097689	missense	probably benign
R7506:Spag9	UTSW	11	94108464	missense	probably damaging	1.00
R7507:Spag9	UTSW	11	94068080	missense	probably benign	0.00
R7513:Spag9	UTSW	11	94112083	missense	probably damaging	1.00
R7655:Spag9	UTSW	11	93996563	missense	possibly damaging	0.56
R7656:Spag9	UTSW	11	93996563	missense	possibly damaging	0.56
R7664:Spag9	UTSW	11	94102160	critical splice donor site	probably null
R7862:Spag9	UTSW	11	94112066	missense	possibly damaging	0.69
R8074:Spag9	UTSW	11	94112051	missense	probably damaging	1.00
R8085:Spag9	UTSW	11	94099044	missense	probably benign
R8469:Spag9	UTSW	11	94091801	missense	probably damaging	1.00
R8547:Spag9	UTSW	11	94122821	missense	possibly damaging	0.84
R8709:Spag9	UTSW	11	94068090	missense	probably benign	0.02
R8732:Spag9	UTSW	11	94071688	critical splice donor site	probably null
R8899:Spag9	UTSW	11	94092869	missense	probably damaging	1.00
R8983:Spag9	UTSW	11	94067989	missense	probably benign
R9043:Spag9	UTSW	11	94060259	missense
R9050:Spag9	UTSW	11	94044468	missense	probably damaging	0.97
R9502:Spag9	UTSW	11	94068966	missense	probably damaging	1.00
R9575:Spag9	UTSW	11	94071583	missense	probably damaging	0.99
R9667:Spag9	UTSW	11	93996293	missense	possibly damaging	0.83
R9683:Spag9	UTSW	11	94097742	missense	probably damaging	1.00
R9774:Spag9	UTSW	11	94114236	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGGGTTTCGTTATAATATTAGAGAAGC -3'
(R):5'- ATTATTTGGAGACCTGTCAAATGAC -3'

Sequencing Primer
(F):5'- TCTAGAAGAGGATGTCAGCTCTCC -3'
(R):5'- GTCAAATGACAGGGCTAATCACTC -3'

Posted On

2019-11-12