Incidental Mutation 'R7665:Spag9'
ID 591876
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Name sperm associated antigen 9
Synonyms JLP, Mapk8ip4, 3110018C07Rik, JIP4, 4733401I23Rik, syd1, 4831406C20Rik
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.737) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 93886917-94016911 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93904480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 112 (Q112L)
Ref Sequence ENSEMBL: ENSMUSP00000042271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041956]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041956
AA Change: Q112L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: Q112L

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 93,988,692 (GRCm39) missense probably benign 0.02
IGL01776:Spag9 APN 11 94,007,553 (GRCm39) splice site probably benign
IGL02095:Spag9 APN 11 93,999,408 (GRCm39) missense probably damaging 1.00
IGL02307:Spag9 APN 11 93,992,986 (GRCm39) critical splice donor site probably null
IGL02417:Spag9 APN 11 94,007,567 (GRCm39) missense probably benign 0.27
IGL02480:Spag9 APN 11 93,999,413 (GRCm39) nonsense probably null
IGL02864:Spag9 APN 11 93,997,487 (GRCm39) missense probably damaging 1.00
IGL02976:Spag9 APN 11 93,974,779 (GRCm39) missense probably benign 0.30
IGL02979:Spag9 APN 11 93,988,190 (GRCm39) missense probably benign
IGL03349:Spag9 APN 11 93,984,335 (GRCm39) missense possibly damaging 0.51
dazzle UTSW 11 93,984,450 (GRCm39) nonsense probably null
R0128:Spag9 UTSW 11 93,984,365 (GRCm39) missense probably damaging 1.00
R0418:Spag9 UTSW 11 93,982,579 (GRCm39) splice site probably benign
R1463:Spag9 UTSW 11 94,007,663 (GRCm39) missense probably damaging 1.00
R1593:Spag9 UTSW 11 93,988,059 (GRCm39) missense probably damaging 1.00
R1605:Spag9 UTSW 11 93,939,365 (GRCm39) missense probably damaging 0.99
R1649:Spag9 UTSW 11 93,999,278 (GRCm39) splice site probably null
R1697:Spag9 UTSW 11 93,887,391 (GRCm39) missense probably benign 0.00
R1952:Spag9 UTSW 11 93,988,184 (GRCm39) missense possibly damaging 0.77
R2011:Spag9 UTSW 11 93,983,201 (GRCm39) nonsense probably null
R2012:Spag9 UTSW 11 93,983,201 (GRCm39) nonsense probably null
R2351:Spag9 UTSW 11 93,983,726 (GRCm39) missense probably damaging 1.00
R2367:Spag9 UTSW 11 94,007,583 (GRCm39) missense probably damaging 1.00
R3027:Spag9 UTSW 11 93,977,203 (GRCm39) missense probably null 1.00
R3766:Spag9 UTSW 11 93,951,109 (GRCm39) intron probably benign
R3777:Spag9 UTSW 11 93,989,852 (GRCm39) critical splice acceptor site probably null
R3937:Spag9 UTSW 11 93,935,305 (GRCm39) missense possibly damaging 0.92
R3937:Spag9 UTSW 11 93,935,243 (GRCm39) missense possibly damaging 0.94
R4417:Spag9 UTSW 11 93,951,172 (GRCm39) intron probably benign
R4445:Spag9 UTSW 11 93,988,079 (GRCm39) missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94,005,177 (GRCm39) critical splice donor site probably null
R4799:Spag9 UTSW 11 93,939,343 (GRCm39) missense probably damaging 0.96
R4799:Spag9 UTSW 11 93,939,342 (GRCm39) missense possibly damaging 0.87
R4816:Spag9 UTSW 11 93,939,425 (GRCm39) intron probably benign
R4843:Spag9 UTSW 11 93,988,644 (GRCm39) missense probably damaging 1.00
R5020:Spag9 UTSW 11 93,988,612 (GRCm39) missense probably benign 0.08
R5119:Spag9 UTSW 11 94,013,548 (GRCm39) missense probably damaging 1.00
R5298:Spag9 UTSW 11 93,990,961 (GRCm39) missense probably damaging 1.00
R5304:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5305:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5395:Spag9 UTSW 11 93,982,577 (GRCm39) splice site probably null
R5636:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5638:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5654:Spag9 UTSW 11 93,981,538 (GRCm39) missense probably damaging 1.00
R5779:Spag9 UTSW 11 94,005,079 (GRCm39) missense probably benign 0.20
R5814:Spag9 UTSW 11 93,973,654 (GRCm39) missense possibly damaging 0.94
R5912:Spag9 UTSW 11 93,935,251 (GRCm39) missense probably damaging 0.98
R6038:Spag9 UTSW 11 94,002,918 (GRCm39) missense probably damaging 1.00
R6038:Spag9 UTSW 11 94,002,918 (GRCm39) missense probably damaging 1.00
R6269:Spag9 UTSW 11 93,935,333 (GRCm39) missense probably benign 0.05
R6294:Spag9 UTSW 11 93,984,311 (GRCm39) critical splice acceptor site probably null
R6389:Spag9 UTSW 11 93,977,137 (GRCm39) missense probably damaging 1.00
R6420:Spag9 UTSW 11 93,977,128 (GRCm39) missense probably damaging 1.00
R6460:Spag9 UTSW 11 93,959,801 (GRCm39) missense probably damaging 1.00
R6482:Spag9 UTSW 11 93,984,328 (GRCm39) missense possibly damaging 0.94
R6860:Spag9 UTSW 11 93,972,196 (GRCm39) missense probably benign 0.25
R7086:Spag9 UTSW 11 93,988,690 (GRCm39) missense probably benign
R7179:Spag9 UTSW 11 93,980,258 (GRCm39) splice site probably null
R7225:Spag9 UTSW 11 93,988,184 (GRCm39) missense probably damaging 0.98
R7351:Spag9 UTSW 11 93,983,802 (GRCm39) missense probably benign 0.00
R7366:Spag9 UTSW 11 93,999,347 (GRCm39) missense possibly damaging 0.56
R7378:Spag9 UTSW 11 94,005,177 (GRCm39) critical splice donor site probably null
R7401:Spag9 UTSW 11 93,988,515 (GRCm39) missense probably benign
R7506:Spag9 UTSW 11 93,999,290 (GRCm39) missense probably damaging 1.00
R7507:Spag9 UTSW 11 93,958,906 (GRCm39) missense probably benign 0.00
R7513:Spag9 UTSW 11 94,002,909 (GRCm39) missense probably damaging 1.00
R7655:Spag9 UTSW 11 93,887,389 (GRCm39) missense possibly damaging 0.56
R7656:Spag9 UTSW 11 93,887,389 (GRCm39) missense possibly damaging 0.56
R7664:Spag9 UTSW 11 93,992,986 (GRCm39) critical splice donor site probably null
R7862:Spag9 UTSW 11 94,002,892 (GRCm39) missense possibly damaging 0.69
R8074:Spag9 UTSW 11 94,002,877 (GRCm39) missense probably damaging 1.00
R8085:Spag9 UTSW 11 93,989,870 (GRCm39) missense probably benign
R8469:Spag9 UTSW 11 93,982,627 (GRCm39) missense probably damaging 1.00
R8547:Spag9 UTSW 11 94,013,647 (GRCm39) missense possibly damaging 0.84
R8709:Spag9 UTSW 11 93,958,916 (GRCm39) missense probably benign 0.02
R8732:Spag9 UTSW 11 93,962,514 (GRCm39) critical splice donor site probably null
R8899:Spag9 UTSW 11 93,983,695 (GRCm39) missense probably damaging 1.00
R8983:Spag9 UTSW 11 93,958,815 (GRCm39) missense probably benign
R9043:Spag9 UTSW 11 93,951,085 (GRCm39) missense
R9050:Spag9 UTSW 11 93,935,294 (GRCm39) missense probably damaging 0.97
R9502:Spag9 UTSW 11 93,959,792 (GRCm39) missense probably damaging 1.00
R9575:Spag9 UTSW 11 93,962,409 (GRCm39) missense probably damaging 0.99
R9667:Spag9 UTSW 11 93,887,119 (GRCm39) missense possibly damaging 0.83
R9683:Spag9 UTSW 11 93,988,568 (GRCm39) missense probably damaging 1.00
R9774:Spag9 UTSW 11 94,005,062 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGGTTTCGTTATAATATTAGAGAAGC -3'
(R):5'- ATTATTTGGAGACCTGTCAAATGAC -3'

Sequencing Primer
(F):5'- TCTAGAAGAGGATGTCAGCTCTCC -3'
(R):5'- GTCAAATGACAGGGCTAATCACTC -3'
Posted On 2019-11-12