Mutagenetix > Incidental Mutation

Incidental Mutation 'R7665:Scin'

591879

Institutional Source

Beutler Lab

Gene Symbol

Scin

Ensembl Gene

ENSMUSG00000002565

Gene Name

scinderin

Synonyms

adseverin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7665 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40059769-40134228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40069415 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 538 (N538I)

Ref Sequence

ENSEMBL: ENSMUSP00000002640 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002640] [ENSMUST00000078481]

AlphaFold

Q60604

Predicted Effect

probably damaging
Transcript: ENSMUST00000002640
AA Change: N538I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002640
Gene: ENSMUSG00000002565
AA Change: N538I

Domain	Start	End	E-Value	Type
GEL	17	114	3.44e-26	SMART
GEL	135	227	3.92e-30	SMART
low complexity region	232	242	N/A	INTRINSIC
GEL	252	347	6.56e-32	SMART
GEL	396	489	7.72e-29	SMART
GEL	510	596	2.33e-23	SMART
GEL	615	710	2.07e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000078481

SMART Domains

Protein: ENSMUSP00000077573
Gene: ENSMUSG00000002565

Domain	Start	End	E-Value	Type
GEL	17	114	3.44e-26	SMART
GEL	135	227	3.92e-30	SMART
low complexity region	232	242	N/A	INTRINSIC
GEL	252	347	6.56e-32	SMART
GEL	396	489	7.72e-29	SMART
GEL	510	610	1.09e-28	SMART

Meta Mutation Damage Score

0.8433

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SCIN is a Ca(2+)-dependent actin-severing and -capping protein (Zunino et al., 2001 [PubMed 11568009]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a conditional allele knocked-out in osteoclasts exhibit impaired osteoclast differentiation and reduced peridontal disease-mediated bone loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	A	G	5: 114,874,323		probably null	Het
A830018L16Rik	T	C	1: 11,972,099	S448P	probably damaging	Het
Abca4	C	T	3: 122,044,490		probably benign	Het
Ackr2	A	G	9: 121,909,308	M250V	probably benign	Het
Actn4	A	G	7: 28,916,207	I147T	probably damaging	Het
Adgrv1	C	T	13: 81,499,142	S3093N	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Brwd1	G	A	16: 96,041,343	T798M	probably benign	Het
Cdk13	G	A	13: 17,772,553	T540I	possibly damaging	Het
Cdkn1c	A	G	7: 143,460,634	V25A	possibly damaging	Het
Col2a1	T	C	15: 97,976,700	E1420G	unknown	Het
Dbf4	G	A	5: 8,397,867	P448S	probably damaging	Het
Dnajb7	T	C	15: 81,407,419	N239S	probably benign	Het
Dnttip1	A	G	2: 164,754,141	D102G	probably damaging	Het
Dpp8	T	A	9: 65,078,718	V830D	probably damaging	Het
Eef1g	T	C	19: 8,968,289	V29A	probably benign	Het
Enpp2	T	A	15: 54,839,394	Y906F	probably damaging	Het
Epb41l4a	A	G	18: 34,006,016	L23P	possibly damaging	Het
Epp13	G	A	7: 6,269,892		probably null	Het
Exoc1	T	A	5: 76,543,573	M248K	probably benign	Het
Fam83b	T	C	9: 76,490,875	Y982C	probably damaging	Het
Fat4	C	T	3: 38,889,178	A740V	probably benign	Het
Fsip2	T	A	2: 82,981,805	S2823T	probably benign	Het
Gckr	T	C	5: 31,297,555			Het
Gpr150	A	T	13: 76,055,974	V284E	probably damaging	Het
Grtp1	T	G	8: 13,177,103	I344L	probably benign	Het
Heatr5a	T	A	12: 51,961,530	N10I	probably damaging	Het
Herc2	C	A	7: 56,153,155	L2109I	probably damaging	Het
Hs1bp3	T	A	12: 8,317,935	D61E	probably damaging	Het
Ifit1bl1	T	A	19: 34,594,883	Y58F	probably benign	Het
Itfg1	A	G	8: 85,764,350	F317L	probably benign	Het
Itsn1	T	C	16: 91,841,603	I764T	unknown	Het
Med8	A	C	4: 118,411,656		probably null	Het
Mpeg1	C	A	19: 12,463,094	P639T	probably damaging	Het
Nedd9	A	G	13: 41,316,309	L456P	probably benign	Het
Neo1	A	G	9: 58,925,795	S556P	probably damaging	Het
Nphp3	T	A	9: 104,005,393		probably null	Het
Nup205	T	C	6: 35,177,620	V53A	possibly damaging	Het
Nvl	A	T	1: 181,134,944	S154T	probably benign	Het
Olfr239	G	T	17: 33,199,629	G194*	probably null	Het
Olfr391-ps	A	T	11: 73,798,961	N265K	probably benign	Het
Olfr615	A	T	7: 103,561,316	I280F	probably benign	Het
Olfr706	A	T	7: 106,886,673	V48D	possibly damaging	Het
Olfr827	T	A	10: 130,211,261		probably null	Het
Olfr92	A	G	17: 37,111,391	M197T	probably benign	Het
Parvg	T	C	15: 84,337,801	I243T	probably damaging	Het
Paxip1	T	A	5: 27,765,738	M538L	unknown	Het
Pgghg	G	T	7: 140,945,469	D428Y	probably damaging	Het
Pik3cd	C	T	4: 149,654,050	V777M	possibly damaging	Het
Plcl2	A	C	17: 50,607,157	K398T	probably benign	Het
Plxna1	A	T	6: 89,324,538		probably null	Het
Rbbp6	T	C	7: 122,994,686	Y514H	possibly damaging	Het
Rbbp6	T	A	7: 122,990,032		probably null	Het
Sdcbp	A	G	4: 6,385,144	D121G	probably benign	Het
Sgk1	T	C	10: 21,996,662	I311T	probably damaging	Het
Shq1	A	C	6: 100,573,756	L407W	probably damaging	Het
Sipa1	A	T	19: 5,651,671	S979T	probably benign	Het
Slc25a37	G	T	14: 69,249,579	T85K	probably benign	Het
Soga3	T	A	10: 29,196,397	Y562N	probably damaging	Het
Spag9	A	T	11: 94,013,654	Q112L	probably damaging	Het
Spg11	A	T	2: 122,066,267	V1686E	probably damaging	Het
Stap2	A	G	17: 55,997,909	V291A	probably benign	Het
Tnk2	C	T	16: 32,680,526	R886C	probably damaging	Het
Tnrc6c	T	A	11: 117,720,951	D138E	possibly damaging	Het
Unc13c	A	G	9: 73,680,474	S1426P	probably benign	Het
Vav1	G	A	17: 57,297,086	V163M	probably damaging	Het
Vmn2r67	T	A	7: 85,151,988	K247*	probably null	Het
Zc2hc1c	T	C	12: 85,296,562	V491A	possibly damaging	Het
Zfp51	A	G	17: 21,463,581	T153A	probably benign	Het
Zyx	A	G	6: 42,356,162	E374G	probably damaging	Het

Other mutations in Scin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Scin	APN	12	40076972	missense	probably benign	0.03
IGL01414:Scin	APN	12	40124699	missense	probably damaging	1.00
IGL01790:Scin	APN	12	40063257	missense	probably benign	0.02
IGL01807:Scin	APN	12	40084289	missense	probably damaging	1.00
IGL01946:Scin	APN	12	40060491	utr 3 prime	probably benign
IGL02040:Scin	APN	12	40069453	intron	probably benign
IGL02391:Scin	APN	12	40077531	missense	probably benign	0.05
IGL03221:Scin	APN	12	40076974	missense	probably benign	0.01
I1329:Scin	UTSW	12	40073330	missense	probably damaging	0.99
PIT4498001:Scin	UTSW	12	40069447	critical splice acceptor site	probably null
R0108:Scin	UTSW	12	40127987	missense	possibly damaging	0.68
R0470:Scin	UTSW	12	40073292	splice site	probably benign
R0477:Scin	UTSW	12	40060516	missense	probably damaging	1.00
R0538:Scin	UTSW	12	40081771	missense	probably damaging	0.98
R0539:Scin	UTSW	12	40081766	missense	possibly damaging	0.65
R0591:Scin	UTSW	12	40080930	critical splice donor site	probably null
R0668:Scin	UTSW	12	40080949	missense	probably damaging	1.00
R0718:Scin	UTSW	12	40079607	missense	probably damaging	1.00
R1473:Scin	UTSW	12	40077502	missense	probably benign
R1566:Scin	UTSW	12	40081674	missense	probably benign	0.17
R1570:Scin	UTSW	12	40084381	splice site	probably benign
R1624:Scin	UTSW	12	40127930	missense	probably benign
R1827:Scin	UTSW	12	40068923	missense	possibly damaging	0.88
R1836:Scin	UTSW	12	40124698	missense	probably damaging	1.00
R1985:Scin	UTSW	12	40133908	critical splice donor site	probably null
R2042:Scin	UTSW	12	40077510	missense	possibly damaging	0.96
R2061:Scin	UTSW	12	40080948	missense	probably damaging	1.00
R2147:Scin	UTSW	12	40080985	missense	probably benign	0.00
R2232:Scin	UTSW	12	40068931	missense	probably damaging	1.00
R2504:Scin	UTSW	12	40081706	missense	probably benign	0.02
R4781:Scin	UTSW	12	40081764	missense	possibly damaging	0.59
R4898:Scin	UTSW	12	40104932	missense	probably benign
R4914:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4915:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4916:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4917:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R4918:Scin	UTSW	12	40069374	missense	possibly damaging	0.79
R5068:Scin	UTSW	12	40124700	missense	probably damaging	1.00
R5098:Scin	UTSW	12	40077542	nonsense	probably null
R5233:Scin	UTSW	12	40077559	missense	probably benign
R5564:Scin	UTSW	12	40124569	missense	probably benign
R5677:Scin	UTSW	12	40063259	missense	probably damaging	1.00
R5967:Scin	UTSW	12	40077538	missense	probably benign	0.35
R6027:Scin	UTSW	12	40077516	missense	probably damaging	1.00
R6130:Scin	UTSW	12	40069436	missense	probably benign	0.01
R6134:Scin	UTSW	12	40060579	missense	probably damaging	1.00
R6135:Scin	UTSW	12	40079808	missense	possibly damaging	0.80
R6439:Scin	UTSW	12	40068946	missense	probably damaging	0.99
R6613:Scin	UTSW	12	40079715	missense	probably benign	0.04
R7127:Scin	UTSW	12	40105072	missense	possibly damaging	0.69
R7234:Scin	UTSW	12	40080958	nonsense	probably null
R7431:Scin	UTSW	12	40133922	missense	probably damaging	1.00
R7609:Scin	UTSW	12	40124589	missense	probably damaging	1.00
R7704:Scin	UTSW	12	40124688	missense	possibly damaging	0.93
R7904:Scin	UTSW	12	40077000	missense	probably damaging	1.00
R7995:Scin	UTSW	12	40079805	missense	probably benign	0.00
R8323:Scin	UTSW	12	40079682	missense	probably benign	0.00
R8489:Scin	UTSW	12	40081020	missense	probably damaging	1.00
R8556:Scin	UTSW	12	40077594	critical splice acceptor site	probably null
R8915:Scin	UTSW	12	40073433	missense	probably damaging	1.00
R9063:Scin	UTSW	12	40084337	missense	possibly damaging	0.49
R9089:Scin	UTSW	12	40081704	nonsense	probably null
R9139:Scin	UTSW	12	40063237	missense	possibly damaging	0.75
R9457:Scin	UTSW	12	40104958	missense	possibly damaging	0.86
R9592:Scin	UTSW	12	40081747	missense	probably benign	0.01
X0018:Scin	UTSW	12	40069433	missense	probably damaging	1.00
Z1176:Scin	UTSW	12	40079604	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- AACTATGAAAGTGGTGACCTTGG -3'
(R):5'- AAAGCCGTGTTTTATTGTCCG -3'

Sequencing Primer
(F):5'- TGACCTTGGGCCCACAG -3'
(R):5'- CAGCTGAACATGTGTCATGGACC -3'

Posted On

2019-11-12