Incidental Mutation 'R7665:Heatr5a'
ID 591880
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene Name HEAT repeat containing 5A
Synonyms D930036F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 51875871-51971321 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 51961530 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 10 (N10I)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
AlphaFold Q5PRF0
Predicted Effect probably damaging
Transcript: ENSMUST00000040583
AA Change: N10I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: N10I

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Meta Mutation Damage Score 0.6416 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,874,323 probably null Het
A830018L16Rik T C 1: 11,972,099 S448P probably damaging Het
Abca4 C T 3: 122,044,490 probably benign Het
Ackr2 A G 9: 121,909,308 M250V probably benign Het
Actn4 A G 7: 28,916,207 I147T probably damaging Het
Adgrv1 C T 13: 81,499,142 S3093N probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Brwd1 G A 16: 96,041,343 T798M probably benign Het
Cdk13 G A 13: 17,772,553 T540I possibly damaging Het
Cdkn1c A G 7: 143,460,634 V25A possibly damaging Het
Col2a1 T C 15: 97,976,700 E1420G unknown Het
Dbf4 G A 5: 8,397,867 P448S probably damaging Het
Dnajb7 T C 15: 81,407,419 N239S probably benign Het
Dnttip1 A G 2: 164,754,141 D102G probably damaging Het
Dpp8 T A 9: 65,078,718 V830D probably damaging Het
Eef1g T C 19: 8,968,289 V29A probably benign Het
Enpp2 T A 15: 54,839,394 Y906F probably damaging Het
Epb41l4a A G 18: 34,006,016 L23P possibly damaging Het
Epp13 G A 7: 6,269,892 probably null Het
Exoc1 T A 5: 76,543,573 M248K probably benign Het
Fam83b T C 9: 76,490,875 Y982C probably damaging Het
Fat4 C T 3: 38,889,178 A740V probably benign Het
Fsip2 T A 2: 82,981,805 S2823T probably benign Het
Gckr T C 5: 31,297,555 Het
Gpr150 A T 13: 76,055,974 V284E probably damaging Het
Grtp1 T G 8: 13,177,103 I344L probably benign Het
Herc2 C A 7: 56,153,155 L2109I probably damaging Het
Hs1bp3 T A 12: 8,317,935 D61E probably damaging Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Itfg1 A G 8: 85,764,350 F317L probably benign Het
Itsn1 T C 16: 91,841,603 I764T unknown Het
Med8 A C 4: 118,411,656 probably null Het
Mpeg1 C A 19: 12,463,094 P639T probably damaging Het
Nedd9 A G 13: 41,316,309 L456P probably benign Het
Neo1 A G 9: 58,925,795 S556P probably damaging Het
Nphp3 T A 9: 104,005,393 probably null Het
Nup205 T C 6: 35,177,620 V53A possibly damaging Het
Nvl A T 1: 181,134,944 S154T probably benign Het
Olfr239 G T 17: 33,199,629 G194* probably null Het
Olfr391-ps A T 11: 73,798,961 N265K probably benign Het
Olfr615 A T 7: 103,561,316 I280F probably benign Het
Olfr706 A T 7: 106,886,673 V48D possibly damaging Het
Olfr827 T A 10: 130,211,261 probably null Het
Olfr92 A G 17: 37,111,391 M197T probably benign Het
Parvg T C 15: 84,337,801 I243T probably damaging Het
Paxip1 T A 5: 27,765,738 M538L unknown Het
Pgghg G T 7: 140,945,469 D428Y probably damaging Het
Pik3cd C T 4: 149,654,050 V777M possibly damaging Het
Plcl2 A C 17: 50,607,157 K398T probably benign Het
Plxna1 A T 6: 89,324,538 probably null Het
Rbbp6 T C 7: 122,994,686 Y514H possibly damaging Het
Rbbp6 T A 7: 122,990,032 probably null Het
Scin T A 12: 40,069,415 N538I probably damaging Het
Sdcbp A G 4: 6,385,144 D121G probably benign Het
Sgk1 T C 10: 21,996,662 I311T probably damaging Het
Shq1 A C 6: 100,573,756 L407W probably damaging Het
Sipa1 A T 19: 5,651,671 S979T probably benign Het
Slc25a37 G T 14: 69,249,579 T85K probably benign Het
Soga3 T A 10: 29,196,397 Y562N probably damaging Het
Spag9 A T 11: 94,013,654 Q112L probably damaging Het
Spg11 A T 2: 122,066,267 V1686E probably damaging Het
Stap2 A G 17: 55,997,909 V291A probably benign Het
Tnk2 C T 16: 32,680,526 R886C probably damaging Het
Tnrc6c T A 11: 117,720,951 D138E possibly damaging Het
Unc13c A G 9: 73,680,474 S1426P probably benign Het
Vav1 G A 17: 57,297,086 V163M probably damaging Het
Vmn2r67 T A 7: 85,151,988 K247* probably null Het
Zc2hc1c T C 12: 85,296,562 V491A possibly damaging Het
Zfp51 A G 17: 21,463,581 T153A probably benign Het
Zyx A G 6: 42,356,162 E374G probably damaging Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 splice site probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R8088:Heatr5a UTSW 12 51947996 missense possibly damaging 0.85
R8205:Heatr5a UTSW 12 51959009 missense probably benign 0.05
R8212:Heatr5a UTSW 12 51899229 missense probably benign 0.00
R8213:Heatr5a UTSW 12 51891443 missense probably damaging 0.96
R8323:Heatr5a UTSW 12 51955506 missense probably benign 0.02
R8326:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8339:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8395:Heatr5a UTSW 12 51916178 missense
R8410:Heatr5a UTSW 12 51938120 missense probably benign 0.01
R8676:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8834:Heatr5a UTSW 12 51909956 critical splice donor site probably null
R8916:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9057:Heatr5a UTSW 12 51939637 missense probably damaging 1.00
R9248:Heatr5a UTSW 12 51916243 missense
R9287:Heatr5a UTSW 12 51920477 missense probably damaging 0.97
R9332:Heatr5a UTSW 12 51899285 missense probably benign 0.33
R9454:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9515:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9654:Heatr5a UTSW 12 51958995 missense probably damaging 1.00
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGGAATCCACCATATTTCACTGC -3'
(R):5'- TCCTGCGGCAGTTCTAAAGC -3'

Sequencing Primer
(F):5'- CCTTTCACAAACTGATAGGTGAC -3'
(R):5'- CTGCGGCAGTTCTAAAGCTATAC -3'
Posted On 2019-11-12