Incidental Mutation 'R7665:Col2a1'
ID 591890
Institutional Source Beutler Lab
Gene Symbol Col2a1
Ensembl Gene ENSMUSG00000022483
Gene Name collagen, type II, alpha 1
Synonyms Rgsc413, M100413, Rgsc856, Col2a-1, M100856, Del1, Col2a, Col2, Lpk
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 97873483-97902525 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97874581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1420 (E1420G)
Ref Sequence ENSEMBL: ENSMUSP00000023123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023123] [ENSMUST00000088355]
AlphaFold P28481
PDB Structure ANTI CITRULLINATED COLLAGEN TYPE 2 ANTIBODY ACC4 IN COMPLEX WITH A CITRULLINATED PEPTIDE [X-RAY DIFFRACTION]
Crystal structure of the arthritogenic antibody M2139 (Fab fragment) in complex with the triple-helical J1 peptide [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000023123
AA Change: E1420G
SMART Domains Protein: ENSMUSP00000023123
Gene: ENSMUSG00000022483
AA Change: E1420G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
Pfam:Collagen 115 175 1.3e-11 PFAM
Pfam:Collagen 199 260 7.2e-11 PFAM
Pfam:Collagen 258 317 1.3e-12 PFAM
Pfam:Collagen 312 377 4e-9 PFAM
low complexity region 395 411 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
internal_repeat_5 456 468 5.45e-5 PROSPERO
low complexity region 471 513 N/A INTRINSIC
internal_repeat_3 516 619 3.99e-13 PROSPERO
internal_repeat_1 524 567 1.6e-17 PROSPERO
low complexity region 621 633 N/A INTRINSIC
low complexity region 636 655 N/A INTRINSIC
low complexity region 659 687 N/A INTRINSIC
low complexity region 696 753 N/A INTRINSIC
internal_repeat_5 756 768 5.45e-5 PROSPERO
low complexity region 783 804 N/A INTRINSIC
Pfam:Collagen 852 918 1.1e-8 PFAM
Pfam:Collagen 876 941 1.9e-9 PFAM
Pfam:Collagen 900 966 2.4e-9 PFAM
Pfam:Collagen 983 1049 2.1e-10 PFAM
low complexity region 1062 1081 N/A INTRINSIC
Pfam:Collagen 1101 1172 3.4e-9 PFAM
Pfam:Collagen 1158 1218 1.3e-9 PFAM
COLFI 1252 1487 3.06e-184 SMART
Predicted Effect unknown
Transcript: ENSMUST00000088355
AA Change: E1352G
SMART Domains Protein: ENSMUSP00000085693
Gene: ENSMUSG00000022483
AA Change: E1352G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Collagen 47 107 1.2e-11 PFAM
Pfam:Collagen 131 192 7.2e-11 PFAM
Pfam:Collagen 190 249 1.3e-12 PFAM
low complexity region 262 314 N/A INTRINSIC
Pfam:Collagen 327 405 3.5e-7 PFAM
Pfam:Collagen 361 429 7.6e-10 PFAM
internal_repeat_3 448 551 1.3e-13 PROSPERO
internal_repeat_7 454 466 2.86e-5 PROSPERO
internal_repeat_1 456 499 4.05e-18 PROSPERO
internal_repeat_6 481 504 1.7e-5 PROSPERO
low complexity region 553 565 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
low complexity region 591 619 N/A INTRINSIC
low complexity region 628 685 N/A INTRINSIC
internal_repeat_4 688 712 8.3e-12 PROSPERO
low complexity region 715 736 N/A INTRINSIC
low complexity region 747 784 N/A INTRINSIC
Pfam:Collagen 808 878 9.8e-9 PFAM
Pfam:Collagen 832 898 2.1e-9 PFAM
Pfam:Collagen 916 979 7.2e-10 PFAM
Pfam:Collagen 937 1005 2.1e-8 PFAM
Pfam:Collagen 973 1049 6e-7 PFAM
Pfam:Collagen 1030 1094 1.5e-10 PFAM
Pfam:Collagen 1088 1150 1.4e-9 PFAM
COLFI 1184 1419 3.06e-184 SMART
Meta Mutation Damage Score 0.8469 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type II collagen, the major component of cartilage and the vitreous humor of the eye. The encoded preproprotein forms homotrimeric, triple helical procollagen that undergoes proteolytic processing during fibirl formation. Mice harboring certain mutations in this gene exhibit severe chondrodysplasia characterized by short limbs and trunch, craniofacial deformities and cleft palate. A complete lack of the encoded protein in mice results in postnatal lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this locus affect cartilage development. Homozygotes die perinatally with anomalies such as shortened limbs without epiphiseal growth plates, cleft palate and persistence of notochord. Heterozygotes are dwarfed with reduced cartilage matrix. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Col2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Col2a1 APN 15 97,874,054 (GRCm39) missense unknown
IGL01286:Col2a1 APN 15 97,892,759 (GRCm39) missense unknown
IGL01369:Col2a1 APN 15 97,875,707 (GRCm39) missense unknown
IGL01747:Col2a1 APN 15 97,889,273 (GRCm39) splice site probably benign
IGL02086:Col2a1 APN 15 97,884,618 (GRCm39) splice site probably null
IGL02549:Col2a1 APN 15 97,875,680 (GRCm39) missense unknown
IGL03289:Col2a1 APN 15 97,878,762 (GRCm39) missense unknown
IGL03369:Col2a1 APN 15 97,879,923 (GRCm39) missense unknown
Foreseen UTSW 15 97,874,674 (GRCm39) missense unknown
FR4304:Col2a1 UTSW 15 97,886,862 (GRCm39) splice site probably null
FR4340:Col2a1 UTSW 15 97,886,862 (GRCm39) splice site probably null
FR4342:Col2a1 UTSW 15 97,886,862 (GRCm39) splice site probably null
FR4589:Col2a1 UTSW 15 97,886,862 (GRCm39) splice site probably null
LCD18:Col2a1 UTSW 15 97,886,862 (GRCm39) splice site probably null
R0124:Col2a1 UTSW 15 97,896,743 (GRCm39) missense unknown
R0227:Col2a1 UTSW 15 97,874,636 (GRCm39) missense unknown
R0690:Col2a1 UTSW 15 97,878,073 (GRCm39) missense unknown
R1434:Col2a1 UTSW 15 97,877,532 (GRCm39) missense probably damaging 0.96
R1473:Col2a1 UTSW 15 97,880,789 (GRCm39) splice site probably benign
R1577:Col2a1 UTSW 15 97,877,083 (GRCm39) missense probably damaging 1.00
R1598:Col2a1 UTSW 15 97,877,131 (GRCm39) missense probably damaging 0.99
R1837:Col2a1 UTSW 15 97,894,522 (GRCm39) splice site probably benign
R2153:Col2a1 UTSW 15 97,885,461 (GRCm39) missense unknown
R2965:Col2a1 UTSW 15 97,873,976 (GRCm39) missense unknown
R2966:Col2a1 UTSW 15 97,873,976 (GRCm39) missense unknown
R3710:Col2a1 UTSW 15 97,888,788 (GRCm39) splice site probably benign
R3838:Col2a1 UTSW 15 97,898,462 (GRCm39) intron probably benign
R3838:Col2a1 UTSW 15 97,886,857 (GRCm39) missense unknown
R4112:Col2a1 UTSW 15 97,881,582 (GRCm39) missense probably benign 0.18
R4417:Col2a1 UTSW 15 97,896,466 (GRCm39) missense unknown
R4656:Col2a1 UTSW 15 97,874,057 (GRCm39) missense unknown
R4960:Col2a1 UTSW 15 97,874,030 (GRCm39) missense unknown
R5008:Col2a1 UTSW 15 97,877,550 (GRCm39) missense probably benign 0.28
R5435:Col2a1 UTSW 15 97,898,391 (GRCm39) intron probably benign
R5473:Col2a1 UTSW 15 97,885,370 (GRCm39) missense unknown
R6042:Col2a1 UTSW 15 97,898,451 (GRCm39) intron probably benign
R6118:Col2a1 UTSW 15 97,896,448 (GRCm39) missense unknown
R6183:Col2a1 UTSW 15 97,886,671 (GRCm39) missense unknown
R6187:Col2a1 UTSW 15 97,886,671 (GRCm39) missense unknown
R6401:Col2a1 UTSW 15 97,883,773 (GRCm39) missense unknown
R6550:Col2a1 UTSW 15 97,874,674 (GRCm39) missense unknown
R6568:Col2a1 UTSW 15 97,875,157 (GRCm39) missense unknown
R6988:Col2a1 UTSW 15 97,902,335 (GRCm39) missense unknown
R7060:Col2a1 UTSW 15 97,874,022 (GRCm39) missense unknown
R7069:Col2a1 UTSW 15 97,896,469 (GRCm39) missense unknown
R7167:Col2a1 UTSW 15 97,898,337 (GRCm39) missense unknown
R7294:Col2a1 UTSW 15 97,885,168 (GRCm39) splice site probably null
R7392:Col2a1 UTSW 15 97,878,032 (GRCm39) nonsense probably null
R7491:Col2a1 UTSW 15 97,874,040 (GRCm39) missense not run
R7583:Col2a1 UTSW 15 97,874,065 (GRCm39) missense unknown
R7872:Col2a1 UTSW 15 97,898,458 (GRCm39) nonsense probably null
R8177:Col2a1 UTSW 15 97,874,654 (GRCm39) missense unknown
R8306:Col2a1 UTSW 15 97,888,849 (GRCm39) critical splice acceptor site probably null
R9343:Col2a1 UTSW 15 97,877,775 (GRCm39) missense probably damaging 0.99
R9458:Col2a1 UTSW 15 97,876,242 (GRCm39) missense unknown
Z1177:Col2a1 UTSW 15 97,896,226 (GRCm39) missense unknown
Z1177:Col2a1 UTSW 15 97,881,854 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATCTTTATTGCCTCTGAATGAG -3'
(R):5'- AGTTCAGCTATGGCGATGGC -3'

Sequencing Primer
(F):5'- AGCCAGTATGGTATACGCTCC -3'
(R):5'- TATGGCGATGGCAACCTG -3'
Posted On 2019-11-12