Incidental Mutation 'R7665:Tnk2'
ID 591891
Institutional Source Beutler Lab
Gene Symbol Tnk2
Ensembl Gene ENSMUSG00000022791
Gene Name tyrosine kinase, non-receptor, 2
Synonyms ACK1, Ack, P21cdc42Hs kinase, Pyk1, activated p21cdc42Hs kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 32643874-32683493 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32680526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 886 (R886C)
Ref Sequence ENSEMBL: ENSMUSP00000110777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115120] [ENSMUST00000115121] [ENSMUST00000115122] [ENSMUST00000115123] [ENSMUST00000115124] [ENSMUST00000115125] [ENSMUST00000115126] [ENSMUST00000131238] [ENSMUST00000152361]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000115120
AA Change: R381C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110773
Gene: ENSMUSG00000022791
AA Change: R381C

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1.1e-8 PFAM
low complexity region 247 264 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 284 351 2.9e-30 PFAM
low complexity region 391 419 N/A INTRINSIC
Pfam:UBA 467 505 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115121
SMART Domains Protein: ENSMUSP00000110774
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 4.5e-9 PFAM
low complexity region 27 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115122
Predicted Effect probably damaging
Transcript: ENSMUST00000115123
AA Change: R871C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110776
Gene: ENSMUSG00000022791
AA Change: R871C

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 3e-30 PFAM
low complexity region 881 909 N/A INTRINSIC
Pfam:UBA 957 995 1.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115124
AA Change: R886C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110777
Gene: ENSMUSG00000022791
AA Change: R886C

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 855 5.3e-29 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115125
AA Change: R871C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110778
Gene: ENSMUSG00000022791
AA Change: R871C

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 7.2e-31 PFAM
low complexity region 881 909 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115126
AA Change: R886C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110779
Gene: ENSMUSG00000022791
AA Change: R886C

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 856 2.9e-30 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131238
SMART Domains Protein: ENSMUSP00000129382
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152361
SMART Domains Protein: ENSMUSP00000125905
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
SCOP:d1jo8a_ 8 38 2e-3 SMART
Pfam:GTPase_binding 39 106 2.8e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase that binds Cdc42Hs in its GTP-bound form and inhibits both the intrinsic and GTPase-activating protein (GAP)-stimulated GTPase activity of Cdc42Hs. This binding is mediated by a unique sequence of 47 amino acids C-terminal to an SH3 domain. The protein may be involved in a regulatory mechanism that sustains the GTP-bound active form of Cdc42Hs and which is directly linked to a tyrosine phosphorylation signal transduction pathway. Several alternatively spliced transcript variants have been identified from this gene, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,874,323 probably null Het
A830018L16Rik T C 1: 11,972,099 S448P probably damaging Het
Abca4 C T 3: 122,044,490 probably benign Het
Ackr2 A G 9: 121,909,308 M250V probably benign Het
Actn4 A G 7: 28,916,207 I147T probably damaging Het
Adgrv1 C T 13: 81,499,142 S3093N probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Brwd1 G A 16: 96,041,343 T798M probably benign Het
Cdk13 G A 13: 17,772,553 T540I possibly damaging Het
Cdkn1c A G 7: 143,460,634 V25A possibly damaging Het
Col2a1 T C 15: 97,976,700 E1420G unknown Het
Dbf4 G A 5: 8,397,867 P448S probably damaging Het
Dnajb7 T C 15: 81,407,419 N239S probably benign Het
Dnttip1 A G 2: 164,754,141 D102G probably damaging Het
Dpp8 T A 9: 65,078,718 V830D probably damaging Het
Eef1g T C 19: 8,968,289 V29A probably benign Het
Enpp2 T A 15: 54,839,394 Y906F probably damaging Het
Epb41l4a A G 18: 34,006,016 L23P possibly damaging Het
Epp13 G A 7: 6,269,892 probably null Het
Exoc1 T A 5: 76,543,573 M248K probably benign Het
Fam83b T C 9: 76,490,875 Y982C probably damaging Het
Fat4 C T 3: 38,889,178 A740V probably benign Het
Fsip2 T A 2: 82,981,805 S2823T probably benign Het
Gckr T C 5: 31,297,555 Het
Gpr150 A T 13: 76,055,974 V284E probably damaging Het
Grtp1 T G 8: 13,177,103 I344L probably benign Het
Heatr5a T A 12: 51,961,530 N10I probably damaging Het
Herc2 C A 7: 56,153,155 L2109I probably damaging Het
Hs1bp3 T A 12: 8,317,935 D61E probably damaging Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Itfg1 A G 8: 85,764,350 F317L probably benign Het
Itsn1 T C 16: 91,841,603 I764T unknown Het
Med8 A C 4: 118,411,656 probably null Het
Mpeg1 C A 19: 12,463,094 P639T probably damaging Het
Nedd9 A G 13: 41,316,309 L456P probably benign Het
Neo1 A G 9: 58,925,795 S556P probably damaging Het
Nphp3 T A 9: 104,005,393 probably null Het
Nup205 T C 6: 35,177,620 V53A possibly damaging Het
Nvl A T 1: 181,134,944 S154T probably benign Het
Olfr239 G T 17: 33,199,629 G194* probably null Het
Olfr391-ps A T 11: 73,798,961 N265K probably benign Het
Olfr615 A T 7: 103,561,316 I280F probably benign Het
Olfr706 A T 7: 106,886,673 V48D possibly damaging Het
Olfr827 T A 10: 130,211,261 probably null Het
Olfr92 A G 17: 37,111,391 M197T probably benign Het
Parvg T C 15: 84,337,801 I243T probably damaging Het
Paxip1 T A 5: 27,765,738 M538L unknown Het
Pgghg G T 7: 140,945,469 D428Y probably damaging Het
Pik3cd C T 4: 149,654,050 V777M possibly damaging Het
Plcl2 A C 17: 50,607,157 K398T probably benign Het
Plxna1 A T 6: 89,324,538 probably null Het
Rbbp6 T C 7: 122,994,686 Y514H possibly damaging Het
Rbbp6 T A 7: 122,990,032 probably null Het
Scin T A 12: 40,069,415 N538I probably damaging Het
Sdcbp A G 4: 6,385,144 D121G probably benign Het
Sgk1 T C 10: 21,996,662 I311T probably damaging Het
Shq1 A C 6: 100,573,756 L407W probably damaging Het
Sipa1 A T 19: 5,651,671 S979T probably benign Het
Slc25a37 G T 14: 69,249,579 T85K probably benign Het
Soga3 T A 10: 29,196,397 Y562N probably damaging Het
Spag9 A T 11: 94,013,654 Q112L probably damaging Het
Spg11 A T 2: 122,066,267 V1686E probably damaging Het
Stap2 A G 17: 55,997,909 V291A probably benign Het
Tnrc6c T A 11: 117,720,951 D138E possibly damaging Het
Unc13c A G 9: 73,680,474 S1426P probably benign Het
Vav1 G A 17: 57,297,086 V163M probably damaging Het
Vmn2r67 T A 7: 85,151,988 K247* probably null Het
Zc2hc1c T C 12: 85,296,562 V491A possibly damaging Het
Zfp51 A G 17: 21,463,581 T153A probably benign Het
Zyx A G 6: 42,356,162 E374G probably damaging Het
Other mutations in Tnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tnk2 APN 16 32680680 missense probably damaging 0.99
IGL02212:Tnk2 APN 16 32680142 missense probably damaging 0.97
IGL02445:Tnk2 APN 16 32675590 missense probably benign 0.00
junior UTSW 16 32680085 missense probably benign
Rookie UTSW 16 32679785 missense probably damaging 1.00
IGL02799:Tnk2 UTSW 16 32665881 splice site probably benign
R0310:Tnk2 UTSW 16 32680590 missense probably benign
R0989:Tnk2 UTSW 16 32680358 missense probably damaging 1.00
R1556:Tnk2 UTSW 16 32670919 critical splice donor site probably null
R1851:Tnk2 UTSW 16 32679462 missense probably damaging 1.00
R1854:Tnk2 UTSW 16 32680142 missense probably damaging 0.97
R1938:Tnk2 UTSW 16 32663742 start gained probably benign
R2137:Tnk2 UTSW 16 32670802 splice site probably null
R2189:Tnk2 UTSW 16 32671421 missense probably damaging 1.00
R3772:Tnk2 UTSW 16 32679822 missense probably damaging 1.00
R4037:Tnk2 UTSW 16 32670796 missense probably damaging 1.00
R4413:Tnk2 UTSW 16 32669501 missense probably damaging 1.00
R4751:Tnk2 UTSW 16 32679857 missense probably damaging 1.00
R4878:Tnk2 UTSW 16 32679630 missense probably damaging 1.00
R4983:Tnk2 UTSW 16 32680465 missense probably damaging 1.00
R5063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
R5541:Tnk2 UTSW 16 32669523 missense probably benign 0.07
R5759:Tnk2 UTSW 16 32680664 missense probably benign
R5888:Tnk2 UTSW 16 32671367 missense probably damaging 1.00
R6142:Tnk2 UTSW 16 32670099 missense probably damaging 1.00
R6372:Tnk2 UTSW 16 32679785 missense probably damaging 1.00
R6717:Tnk2 UTSW 16 32670869 missense probably damaging 1.00
R6939:Tnk2 UTSW 16 32663878 missense probably damaging 1.00
R7157:Tnk2 UTSW 16 32681168 missense probably damaging 1.00
R7292:Tnk2 UTSW 16 32680800 missense probably benign
R7362:Tnk2 UTSW 16 32675520 critical splice acceptor site probably null
R7477:Tnk2 UTSW 16 32677891 splice site probably null
R7558:Tnk2 UTSW 16 32680085 missense probably benign
R7731:Tnk2 UTSW 16 32670134 missense possibly damaging 0.69
R7867:Tnk2 UTSW 16 32681235 missense probably damaging 0.99
R8011:Tnk2 UTSW 16 32668365 missense probably benign 0.00
R8167:Tnk2 UTSW 16 32680262 missense probably damaging 1.00
R8738:Tnk2 UTSW 16 32665900 missense probably damaging 1.00
R9241:Tnk2 UTSW 16 32670098 missense probably damaging 1.00
R9267:Tnk2 UTSW 16 32675671 missense probably damaging 1.00
X0063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACCACTCAAAGCTTTG -3'
(R):5'- ATCTGGACCTTGTCTGCTGG -3'

Sequencing Primer
(F):5'- AGCTTTGCCTCAGACCCTAAGTATG -3'
(R):5'- ACCTTGTCTGCTGGCCGAG -3'
Posted On 2019-11-12