Incidental Mutation 'R7665:Itsn1'
ID 591893
Institutional Source Beutler Lab
Gene Symbol Itsn1
Ensembl Gene ENSMUSG00000022957
Gene Name intersectin 1 (SH3 domain protein 1A)
Synonyms Eh domain, SH3 domain regulator of endocytosis 1, Sh3p17, Ese1, Intersectin-L, EHSH1
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 91526198-91717479 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91638491 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 764 (I764T)
Ref Sequence ENSEMBL: ENSMUSP00000056011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056482] [ENSMUST00000064797] [ENSMUST00000113993] [ENSMUST00000113996] [ENSMUST00000113999] [ENSMUST00000114001] [ENSMUST00000114002] [ENSMUST00000143023] [ENSMUST00000153741] [ENSMUST00000159295]
AlphaFold Q9Z0R4
Predicted Effect unknown
Transcript: ENSMUST00000056482
AA Change: I764T
SMART Domains Protein: ENSMUSP00000056011
Gene: ENSMUSG00000022957
AA Change: I764T

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000064797
AA Change: I764T
SMART Domains Protein: ENSMUSP00000066361
Gene: ENSMUSG00000022957
AA Change: I764T

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
RhoGEF 1239 1420 1e-63 SMART
PH 1461 1571 6.07e-13 SMART
C2 1595 1692 1.58e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113993
AA Change: I764T
SMART Domains Protein: ENSMUSP00000109626
Gene: ENSMUSG00000022957
AA Change: I764T

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1004 1064 2.46e-16 SMART
SH3 1085 1140 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113996
AA Change: I764T
SMART Domains Protein: ENSMUSP00000109629
Gene: ENSMUSG00000022957
AA Change: I764T

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 999 1059 2.46e-16 SMART
SH3 1080 1135 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113999
AA Change: I764T
SMART Domains Protein: ENSMUSP00000109632
Gene: ENSMUSG00000022957
AA Change: I764T

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114001
AA Change: I727T
SMART Domains Protein: ENSMUSP00000109634
Gene: ENSMUSG00000022957
AA Change: I727T

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 145 155 N/A INTRINSIC
EH 177 272 2.55e-49 SMART
EFh 221 249 1.77e-2 SMART
low complexity region 293 305 N/A INTRINSIC
coiled coil region 315 410 N/A INTRINSIC
coiled coil region 431 478 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
coiled coil region 524 624 N/A INTRINSIC
low complexity region 650 659 N/A INTRINSIC
SH3 704 761 1.05e-19 SMART
SH3 872 926 2.64e-16 SMART
SH3 961 1015 1.82e-19 SMART
SH3 1033 1093 2.46e-16 SMART
SH3 1114 1169 7.97e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114002
AA Change: I764T
SMART Domains Protein: ENSMUSP00000109635
Gene: ENSMUSG00000022957
AA Change: I764T

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
RhoGEF 1234 1415 1e-63 SMART
PH 1456 1566 6.07e-13 SMART
C2 1590 1687 1.58e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143023
SMART Domains Protein: ENSMUSP00000119654
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
SH3 1 37 2.4e0 SMART
low complexity region 191 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153741
AA Change: I57T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117320
Gene: ENSMUSG00000022957
AA Change: I57T

DomainStartEndE-ValueType
SH3 34 77 3.83e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic membrane-associated protein that indirectly coordinates endocytic membrane traffic with the actin assembly machinery. In addition, the encoded protein may regulate the formation of clathrin-coated vesicles and could be involved in synaptic vesicle recycling. This protein has been shown to interact with dynamin, CDC42, SNAP23, SNAP25, SPIN90, EPS15, EPN1, EPN2, and STN2. Multiple transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been characterized so far. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a gene trapped allele exhibit embryonic lethal. Mice homozygous for a null allele exhibit some postnatal lethality and impaired vesicle recycling in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Rbbp6 T A 7: 122,589,255 (GRCm39) probably null Het
Rbbp6 T C 7: 122,593,909 (GRCm39) Y514H possibly damaging Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Itsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Itsn1 APN 16 91,603,089 (GRCm39) unclassified probably benign
IGL01799:Itsn1 APN 16 91,645,770 (GRCm39) missense probably damaging 1.00
IGL02328:Itsn1 APN 16 91,612,295 (GRCm39) missense probably damaging 1.00
IGL02333:Itsn1 APN 16 91,617,564 (GRCm39) intron probably benign
IGL02503:Itsn1 APN 16 91,686,092 (GRCm39) missense possibly damaging 0.62
IGL02628:Itsn1 APN 16 91,696,511 (GRCm39) missense possibly damaging 0.79
IGL02666:Itsn1 APN 16 91,617,606 (GRCm39) intron probably benign
IGL03007:Itsn1 APN 16 91,581,050 (GRCm39) splice site probably benign
IGL03223:Itsn1 APN 16 91,702,194 (GRCm39) missense probably benign 0.00
raphael UTSW 16 91,617,684 (GRCm39) intron probably benign
Sector UTSW 16 91,705,375 (GRCm39) critical splice donor site probably null
Weevil UTSW 16 91,615,440 (GRCm39) intron probably benign
R0234:Itsn1 UTSW 16 91,625,168 (GRCm39) nonsense probably null
R0234:Itsn1 UTSW 16 91,625,168 (GRCm39) nonsense probably null
R0255:Itsn1 UTSW 16 91,602,978 (GRCm39) unclassified probably benign
R0432:Itsn1 UTSW 16 91,612,408 (GRCm39) missense probably damaging 1.00
R0455:Itsn1 UTSW 16 91,665,036 (GRCm39) intron probably benign
R0471:Itsn1 UTSW 16 91,696,477 (GRCm39) missense probably damaging 1.00
R0558:Itsn1 UTSW 16 91,696,511 (GRCm39) missense possibly damaging 0.79
R0563:Itsn1 UTSW 16 91,617,684 (GRCm39) intron probably benign
R1657:Itsn1 UTSW 16 91,706,111 (GRCm39) missense probably damaging 1.00
R1671:Itsn1 UTSW 16 91,609,038 (GRCm39) missense probably damaging 1.00
R1742:Itsn1 UTSW 16 91,613,847 (GRCm39) critical splice donor site probably null
R1859:Itsn1 UTSW 16 91,686,042 (GRCm39) intron probably benign
R1898:Itsn1 UTSW 16 91,696,468 (GRCm39) missense probably damaging 1.00
R2016:Itsn1 UTSW 16 91,702,389 (GRCm39) critical splice donor site probably null
R2221:Itsn1 UTSW 16 91,650,656 (GRCm39) intron probably benign
R2244:Itsn1 UTSW 16 91,650,659 (GRCm39) missense probably null
R3160:Itsn1 UTSW 16 91,649,932 (GRCm39) nonsense probably null
R3162:Itsn1 UTSW 16 91,649,932 (GRCm39) nonsense probably null
R3814:Itsn1 UTSW 16 91,649,809 (GRCm39) missense possibly damaging 0.96
R4162:Itsn1 UTSW 16 91,649,790 (GRCm39) missense probably benign 0.00
R4254:Itsn1 UTSW 16 91,615,440 (GRCm39) intron probably benign
R4319:Itsn1 UTSW 16 91,615,440 (GRCm39) intron probably benign
R4321:Itsn1 UTSW 16 91,615,440 (GRCm39) intron probably benign
R4323:Itsn1 UTSW 16 91,615,440 (GRCm39) intron probably benign
R4326:Itsn1 UTSW 16 91,650,743 (GRCm39) intron probably benign
R4515:Itsn1 UTSW 16 91,696,537 (GRCm39) missense probably damaging 0.99
R4584:Itsn1 UTSW 16 91,617,471 (GRCm39) intron probably benign
R4600:Itsn1 UTSW 16 91,696,475 (GRCm39) missense probably damaging 1.00
R4649:Itsn1 UTSW 16 91,638,476 (GRCm39) missense probably damaging 1.00
R4834:Itsn1 UTSW 16 91,703,677 (GRCm39) nonsense probably null
R4868:Itsn1 UTSW 16 91,582,205 (GRCm39) missense probably damaging 0.98
R5036:Itsn1 UTSW 16 91,579,123 (GRCm39) splice site probably benign
R5122:Itsn1 UTSW 16 91,690,732 (GRCm39) intron probably benign
R5161:Itsn1 UTSW 16 91,705,726 (GRCm39) missense possibly damaging 0.95
R5437:Itsn1 UTSW 16 91,615,479 (GRCm39) intron probably benign
R5538:Itsn1 UTSW 16 91,580,990 (GRCm39) missense probably damaging 1.00
R5683:Itsn1 UTSW 16 91,702,268 (GRCm39) missense probably benign 0.00
R5697:Itsn1 UTSW 16 91,598,477 (GRCm39) missense possibly damaging 0.56
R5749:Itsn1 UTSW 16 91,703,743 (GRCm39) missense probably damaging 0.99
R6083:Itsn1 UTSW 16 91,649,899 (GRCm39) missense probably benign 0.01
R6148:Itsn1 UTSW 16 91,613,740 (GRCm39) missense probably damaging 1.00
R6291:Itsn1 UTSW 16 91,664,984 (GRCm39) intron probably benign
R6524:Itsn1 UTSW 16 91,708,883 (GRCm39) missense probably damaging 0.96
R7175:Itsn1 UTSW 16 91,664,938 (GRCm39) missense unknown
R7261:Itsn1 UTSW 16 91,702,194 (GRCm39) missense probably benign 0.00
R7320:Itsn1 UTSW 16 91,636,587 (GRCm39) missense unknown
R7366:Itsn1 UTSW 16 91,705,338 (GRCm39) missense unknown
R7462:Itsn1 UTSW 16 91,650,073 (GRCm39) missense possibly damaging 0.53
R7720:Itsn1 UTSW 16 91,664,971 (GRCm39) missense unknown
R7856:Itsn1 UTSW 16 91,705,375 (GRCm39) critical splice donor site probably null
R7864:Itsn1 UTSW 16 91,598,454 (GRCm39) missense possibly damaging 0.47
R7896:Itsn1 UTSW 16 91,615,446 (GRCm39) missense unknown
R7897:Itsn1 UTSW 16 91,615,446 (GRCm39) missense unknown
R7980:Itsn1 UTSW 16 91,702,182 (GRCm39) missense unknown
R7998:Itsn1 UTSW 16 91,647,824 (GRCm39) missense unknown
R8075:Itsn1 UTSW 16 91,686,097 (GRCm39) missense unknown
R8144:Itsn1 UTSW 16 91,708,893 (GRCm39) missense unknown
R8160:Itsn1 UTSW 16 91,615,446 (GRCm39) missense unknown
R8161:Itsn1 UTSW 16 91,615,446 (GRCm39) missense unknown
R8176:Itsn1 UTSW 16 91,645,597 (GRCm39) splice site probably null
R8215:Itsn1 UTSW 16 91,608,996 (GRCm39) missense probably damaging 0.99
R8385:Itsn1 UTSW 16 91,690,699 (GRCm39) missense unknown
R8725:Itsn1 UTSW 16 91,636,721 (GRCm39) missense unknown
R9012:Itsn1 UTSW 16 91,645,849 (GRCm39) missense unknown
R9039:Itsn1 UTSW 16 91,703,658 (GRCm39) missense unknown
R9092:Itsn1 UTSW 16 91,609,002 (GRCm39) missense possibly damaging 0.86
R9134:Itsn1 UTSW 16 91,666,514 (GRCm39) missense unknown
R9401:Itsn1 UTSW 16 91,612,408 (GRCm39) missense probably damaging 1.00
R9449:Itsn1 UTSW 16 91,625,264 (GRCm39) makesense probably null
R9568:Itsn1 UTSW 16 91,649,782 (GRCm39) missense probably benign
R9616:Itsn1 UTSW 16 91,650,055 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CATAGACTAACAGCTGTCCGC -3'
(R):5'- CAGTGCTAGCTTTAGACACAATC -3'

Sequencing Primer
(F):5'- ACTAACAGCTGTCCGCCTTGG -3'
(R):5'- CAACTTAAGGTTAAAAGCAGGCTAC -3'
Posted On 2019-11-12