Incidental Mutation 'R7666:Chrng'
ID591908
Institutional Source Beutler Lab
Gene Symbol Chrng
Ensembl Gene ENSMUSG00000026253
Gene Namecholinergic receptor, nicotinic, gamma polypeptide
SynonymsAcrg, Achr-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7666 (G1)
Quality Score195.009
Status Validated
Chromosome1
Chromosomal Location87204657-87212694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87209453 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 278 (T278S)
Ref Sequence ENSEMBL: ENSMUSP00000027470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027470] [ENSMUST00000050876] [ENSMUST00000076362] [ENSMUST00000113230] [ENSMUST00000113231] [ENSMUST00000113232] [ENSMUST00000113233] [ENSMUST00000113235] [ENSMUST00000123735] [ENSMUST00000185763] [ENSMUST00000186038] [ENSMUST00000188796]
Predicted Effect probably benign
Transcript: ENSMUST00000027470
AA Change: T278S

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027470
Gene: ENSMUSG00000026253
AA Change: T278S

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 241 7.9e-72 PFAM
Pfam:Neur_chan_memb 248 494 9.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050876
SMART Domains Protein: ENSMUSP00000053403
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 2.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076362
SMART Domains Protein: ENSMUSP00000075699
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 4.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113230
SMART Domains Protein: ENSMUSP00000108856
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 50 212 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113231
SMART Domains Protein: ENSMUSP00000108857
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 50 212 4.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113232
SMART Domains Protein: ENSMUSP00000108858
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113233
SMART Domains Protein: ENSMUSP00000108859
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 8.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113235
SMART Domains Protein: ENSMUSP00000108861
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 1.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123735
SMART Domains Protein: ENSMUSP00000137771
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 50 128 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185763
SMART Domains Protein: ENSMUSP00000139600
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 20 72 1.4e-6 PFAM
Pfam:Neur_chan_LBD 117 255 1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186038
SMART Domains Protein: ENSMUSP00000141001
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 220 1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188796
SMART Domains Protein: ENSMUSP00000140796
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 142 1.3e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian muscle-type acetylcholine receptor is a transmembrane pentameric glycoprotein with two alpha subunits, one beta, one delta, and one epsilon (in adult skeletal muscle) or gamma (in fetal and denervated muscle) subunit. This gene, which encodes the gamma subunit, is expressed prior to the thirty-third week of gestation in humans. The gamma subunit of the acetylcholine receptor plays a role in neuromuscular organogenesis and ligand binding and disruption of gamma subunit expression prevents the correct localization of the receptor in cell membranes. Mutations in this gene cause Escobar syndrome and a lethal form of multiple pterygium syndrome. Muscle-type acetylcholine receptor is the major antigen in the autoimmune disease myasthenia gravis.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display perinatal and postnatal lethality, paradoxical breathing, abnormal skeletal muscle morphology, abnormal neuromuscular junction morphology and physiology, and are unable to suckle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 G A 4: 139,633,957 V72M probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atl3 T C 19: 7,510,040 S107P probably benign Het
Brpf3 T C 17: 28,810,572 L502P possibly damaging Het
C6 T A 15: 4,789,505 S440T probably damaging Het
Car3 A G 3: 14,870,064 H177R probably benign Het
Ccdc148 A G 2: 58,934,500 W310R probably damaging Het
Cchcr1 C T 17: 35,526,486 T401I probably benign Het
Cdk13 G A 13: 17,772,576 probably benign Het
Celsr2 A G 3: 108,398,588 S2067P probably benign Het
Clec14a T A 12: 58,267,757 T360S probably benign Het
Cr2 A G 1: 195,154,225 Y877H probably damaging Het
Crybg3 A T 16: 59,559,337 L518* probably null Het
Cyp2c38 A T 19: 39,438,242 V205D possibly damaging Het
Dlg5 G A 14: 24,157,799 P1113L probably damaging Het
Dnah7a A T 1: 53,547,297 V1465E probably benign Het
Fbn1 C T 2: 125,306,471 C2619Y probably damaging Het
Fbxl4 A G 4: 22,376,869 T102A probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gimap8 A C 6: 48,659,155 N618T probably damaging Het
Gk5 T A 9: 96,153,107 F286L probably damaging Het
Gm13078 A T 4: 143,728,515 Y461F probably benign Het
Gucy2c G A 6: 136,697,968 S1039L probably benign Het
Hmcn2 C T 2: 31,380,233 P1161S probably damaging Het
Hnrnpa2b1 A T 6: 51,466,937 V78E possibly damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ltbp3 C T 19: 5,747,006 S387L possibly damaging Het
Mrpl48 A G 7: 100,565,201 V64A probably benign Het
Muc16 T C 9: 18,558,427 Y7284C probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myh4 A T 11: 67,256,281 D1584V probably damaging Het
Myl7 A G 11: 5,897,140 F138L possibly damaging Het
Nek5 T C 8: 22,090,517 K395R probably benign Het
Olfr1328 T A 4: 118,934,264 T195S probably damaging Het
Olfr1448 A G 19: 12,920,162 L49P probably damaging Het
Olfr720 A T 14: 14,176,075 D2E probably benign Het
Phf7 C T 14: 31,240,354 E165K probably damaging Het
Pnpla6 A G 8: 3,541,591 Y1213C probably benign Het
Ppp1r9a A T 6: 5,143,238 K1005N probably benign Het
Ppp2r3d A T 9: 124,440,873 D8E probably damaging Het
Ptprn2 C A 12: 116,841,320 R152S probably benign Het
Smc5 A T 19: 23,229,017 D724E probably benign Het
Snx30 T C 4: 59,885,047 V229A probably benign Het
Spata31d1c A C 13: 65,036,000 N452T probably benign Het
Tacc2 C T 7: 130,716,814 probably benign Het
Thsd7a C T 6: 12,379,438 D996N Het
Tubb2b A G 13: 34,128,135 L225P probably damaging Het
Ubr4 A G 4: 139,413,480 T1237A possibly damaging Het
Unc50 G A 1: 37,431,415 R40Q possibly damaging Het
Usp31 T C 7: 121,649,181 E1013G possibly damaging Het
Vwa5a A G 9: 38,733,963 D448G probably benign Het
Wnt5a T C 14: 28,518,372 S160P possibly damaging Het
Zfp618 T A 4: 63,132,717 Y578* probably null Het
Zfp804a C T 2: 82,259,060 Q1078* probably null Het
Zfp808 C T 13: 62,171,411 T131M probably benign Het
Other mutations in Chrng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Chrng APN 1 87206747 missense probably damaging 0.99
IGL02947:Chrng APN 1 87209884 unclassified probably null
IGL03014:Chrng UTSW 1 87211037 critical splice donor site probably null
R1051:Chrng UTSW 1 87209063 missense possibly damaging 0.70
R1346:Chrng UTSW 1 87208263 missense probably benign 0.09
R1368:Chrng UTSW 1 87205853 missense probably damaging 1.00
R1588:Chrng UTSW 1 87207507 missense probably damaging 1.00
R1703:Chrng UTSW 1 87210906 missense possibly damaging 0.63
R2852:Chrng UTSW 1 87206706 missense probably benign 0.01
R3707:Chrng UTSW 1 87210611 nonsense probably null
R4780:Chrng UTSW 1 87207524 missense probably damaging 1.00
R5818:Chrng UTSW 1 87209801 missense probably benign 0.45
R5871:Chrng UTSW 1 87206729 missense possibly damaging 0.95
R6058:Chrng UTSW 1 87211352 missense probably damaging 1.00
R6136:Chrng UTSW 1 87209801 missense probably benign 0.45
R7086:Chrng UTSW 1 87211013 missense probably benign 0.06
R7229:Chrng UTSW 1 87209444 missense probably benign 0.27
R7261:Chrng UTSW 1 87207240 intron probably null
R7572:Chrng UTSW 1 87209114 missense probably damaging 1.00
T0975:Chrng UTSW 1 87210626 missense probably benign 0.00
X0063:Chrng UTSW 1 87206706 missense probably benign 0.01
Z1177:Chrng UTSW 1 87205995 missense unknown
Z1177:Chrng UTSW 1 87206298 missense probably benign 0.10
Z1177:Chrng UTSW 1 87208263 missense probably benign 0.09
Z1177:Chrng UTSW 1 87208303 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCTTATGACACAGGGCAC -3'
(R):5'- TGGAAGGAAGGCCATTGTC -3'

Sequencing Primer
(F):5'- CCACAATCCTAGGACAAGGGTAGTG -3'
(R):5'- GGAAGGCCATTGTCAAAAGCCTC -3'
Posted On2019-11-12