Incidental Mutation 'R7666:Car3'
ID591914
Institutional Source Beutler Lab
Gene Symbol Car3
Ensembl Gene ENSMUSG00000027559
Gene Namecarbonic anhydrase 3
SynonymsCar-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7666 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location14863512-14872523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14870064 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 177 (H177R)
Ref Sequence ENSEMBL: ENSMUSP00000029076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029076]
Predicted Effect probably benign
Transcript: ENSMUST00000029076
AA Change: H177R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029076
Gene: ENSMUSG00000027559
AA Change: H177R

DomainStartEndE-ValueType
Carb_anhydrase 5 259 2.72e-135 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrase III (CAIII) is a member of a multigene family (at least six separate genes are known) that encodes carbonic anhydrase isozymes. These carbonic anhydrases are a class of metalloenzymes that catalyze the reversible hydration of carbon dioxide and are differentially expressed in a number of cell types. The expression of the CA3 gene is strictly tissue specific and present at high levels in skeletal muscle and much lower levels in cardiac and smooth muscle. A proportion of carriers of Duchenne muscle dystrophy have a higher CA3 level than normal. The gene spans 10.3 kb and contains seven exons and six introns. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit a normal life span and a normal response to hyperoxic challenge. Mutant muscles display shorter half-relaxation times for both single and tetanic twitches but show normal fatigability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 G A 4: 139,633,957 V72M probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atl3 T C 19: 7,510,040 S107P probably benign Het
Brpf3 T C 17: 28,810,572 L502P possibly damaging Het
C6 T A 15: 4,789,505 S440T probably damaging Het
Ccdc148 A G 2: 58,934,500 W310R probably damaging Het
Cchcr1 C T 17: 35,526,486 T401I probably benign Het
Cdk13 G A 13: 17,772,576 probably benign Het
Celsr2 A G 3: 108,398,588 S2067P probably benign Het
Chrng A T 1: 87,209,453 T278S probably benign Het
Clec14a T A 12: 58,267,757 T360S probably benign Het
Cr2 A G 1: 195,154,225 Y877H probably damaging Het
Crybg3 A T 16: 59,559,337 L518* probably null Het
Cyp2c38 A T 19: 39,438,242 V205D possibly damaging Het
Dlg5 G A 14: 24,157,799 P1113L probably damaging Het
Dnah7a A T 1: 53,547,297 V1465E probably benign Het
Fbn1 C T 2: 125,306,471 C2619Y probably damaging Het
Fbxl4 A G 4: 22,376,869 T102A probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gimap8 A C 6: 48,659,155 N618T probably damaging Het
Gk5 T A 9: 96,153,107 F286L probably damaging Het
Gm13078 A T 4: 143,728,515 Y461F probably benign Het
Gucy2c G A 6: 136,697,968 S1039L probably benign Het
Hmcn2 C T 2: 31,380,233 P1161S probably damaging Het
Hnrnpa2b1 A T 6: 51,466,937 V78E possibly damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ltbp3 C T 19: 5,747,006 S387L possibly damaging Het
Mrpl48 A G 7: 100,565,201 V64A probably benign Het
Muc16 T C 9: 18,558,427 Y7284C probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myh4 A T 11: 67,256,281 D1584V probably damaging Het
Myl7 A G 11: 5,897,140 F138L possibly damaging Het
Nek5 T C 8: 22,090,517 K395R probably benign Het
Olfr1328 T A 4: 118,934,264 T195S probably damaging Het
Olfr1448 A G 19: 12,920,162 L49P probably damaging Het
Olfr720 A T 14: 14,176,075 D2E probably benign Het
Phf7 C T 14: 31,240,354 E165K probably damaging Het
Pnpla6 A G 8: 3,541,591 Y1213C probably benign Het
Ppp1r9a A T 6: 5,143,238 K1005N probably benign Het
Ppp2r3d A T 9: 124,440,873 D8E probably damaging Het
Ptprn2 C A 12: 116,841,320 R152S probably benign Het
Smc5 A T 19: 23,229,017 D724E probably benign Het
Snx30 T C 4: 59,885,047 V229A probably benign Het
Spata31d1c A C 13: 65,036,000 N452T probably benign Het
Tacc2 C T 7: 130,716,814 probably benign Het
Thsd7a C T 6: 12,379,438 D996N Het
Tubb2b A G 13: 34,128,135 L225P probably damaging Het
Ubr4 A G 4: 139,413,480 T1237A possibly damaging Het
Unc50 G A 1: 37,431,415 R40Q possibly damaging Het
Usp31 T C 7: 121,649,181 E1013G possibly damaging Het
Vwa5a A G 9: 38,733,963 D448G probably benign Het
Wnt5a T C 14: 28,518,372 S160P possibly damaging Het
Zfp618 T A 4: 63,132,717 Y578* probably null Het
Zfp804a C T 2: 82,259,060 Q1078* probably null Het
Zfp808 C T 13: 62,171,411 T131M probably benign Het
Other mutations in Car3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Car3 APN 3 14868379 missense probably benign 0.03
IGL02423:Car3 APN 3 14866851 missense probably damaging 1.00
R0624:Car3 UTSW 3 14866804 missense probably benign 0.16
R1775:Car3 UTSW 3 14864432 missense probably benign 0.01
R4861:Car3 UTSW 3 14866896 missense probably damaging 0.99
R4861:Car3 UTSW 3 14866896 missense probably damaging 0.99
R5856:Car3 UTSW 3 14871641 missense probably damaging 1.00
R6273:Car3 UTSW 3 14871617 missense probably benign 0.14
R7481:Car3 UTSW 3 14863572 start codon destroyed probably benign 0.41
Z1177:Car3 UTSW 3 14871636 missense
Predicted Primers PCR Primer
(F):5'- CTGTGATTGACTAGTGAAGGGC -3'
(R):5'- TGAGACATCTGAGGACCACG -3'

Sequencing Primer
(F):5'- TAGTGAAGGGCCCGAACCTATTC -3'
(R):5'- AGTCTAGCTCTCAACATCTATTTCAG -3'
Posted On2019-11-12