Incidental Mutation 'R0239:Kif14'
ID59192
Institutional Source Beutler Lab
Gene Symbol Kif14
Ensembl Gene ENSMUSG00000041498
Gene Namekinesin family member 14
SynonymsN-3 kinesin, D1Ertd367e
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R0239 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136466343-136531511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136527393 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1551 (E1551G)
Ref Sequence ENSEMBL: ENSMUSP00000044257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000201676]
Predicted Effect probably damaging
Transcript: ENSMUST00000047817
AA Change: E1551G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: E1551G

DomainStartEndE-ValueType
KISc 341 694 1.45e-180 SMART
FHA 809 861 1.46e-7 SMART
coiled coil region 911 1060 N/A INTRINSIC
low complexity region 1169 1179 N/A INTRINSIC
low complexity region 1548 1559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189413
AA Change: E1601G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: E1601G

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 744 1.45e-180 SMART
FHA 859 911 1.46e-7 SMART
coiled coil region 961 1110 N/A INTRINSIC
low complexity region 1219 1229 N/A INTRINSIC
low complexity region 1598 1609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190220
Predicted Effect probably benign
Transcript: ENSMUST00000201676
SMART Domains Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 497 3.7e-6 SMART
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Greb1l C T 18: 10,458,567 probably benign Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Il4ra T C 7: 125,575,199 probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Klc1 A G 12: 111,785,324 probably benign Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Mfsd7a G T 5: 108,444,016 probably benign Het
Micu2 G A 14: 57,917,378 probably benign Het
Mrrf T C 2: 36,177,281 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Pzp C T 6: 128,489,156 probably benign Het
Raet1c C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Scgb1b2 T A 7: 31,291,730 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Kif14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00159:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00160:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00164:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00310:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00330:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00335:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00434:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00468:Kif14 APN 1 136469018 missense probably benign 0.11
IGL01330:Kif14 APN 1 136476374 missense probably damaging 0.99
IGL01530:Kif14 APN 1 136478419 splice site probably benign
IGL01622:Kif14 APN 1 136497356 splice site probably benign
IGL01689:Kif14 APN 1 136519642 missense probably damaging 0.99
IGL02115:Kif14 APN 1 136496567 splice site probably benign
IGL02252:Kif14 APN 1 136478392 missense probably damaging 1.00
IGL02259:Kif14 APN 1 136500102 missense probably benign
IGL02439:Kif14 APN 1 136490261 missense probably damaging 1.00
IGL02590:Kif14 APN 1 136496004 missense probably benign 0.00
IGL02606:Kif14 APN 1 136496593 missense probably damaging 1.00
IGL03253:Kif14 APN 1 136487460 missense probably damaging 0.97
R0106:Kif14 UTSW 1 136479924 splice site probably benign
R0193:Kif14 UTSW 1 136468438 missense probably benign 0.00
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0329:Kif14 UTSW 1 136496026 splice site probably benign
R0346:Kif14 UTSW 1 136468160 missense probably damaging 1.00
R0393:Kif14 UTSW 1 136482418 missense probably damaging 1.00
R0519:Kif14 UTSW 1 136469147 missense probably damaging 1.00
R0590:Kif14 UTSW 1 136482472 missense probably damaging 0.97
R0633:Kif14 UTSW 1 136527305 missense probably damaging 0.96
R0657:Kif14 UTSW 1 136469102 missense probably benign 0.07
R0831:Kif14 UTSW 1 136525871 splice site probably benign
R0971:Kif14 UTSW 1 136519654 missense probably damaging 0.98
R1018:Kif14 UTSW 1 136495841 splice site probably benign
R1520:Kif14 UTSW 1 136503324 missense probably benign 0.00
R1713:Kif14 UTSW 1 136527464 missense probably benign 0.00
R1728:Kif14 UTSW 1 136468279 missense probably benign
R1728:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1728:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1728:Kif14 UTSW 1 136490332 missense probably benign
R1728:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1728:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1728:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1729:Kif14 UTSW 1 136468279 missense probably benign
R1729:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1729:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1729:Kif14 UTSW 1 136490332 missense probably benign
R1729:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1729:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1729:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1730:Kif14 UTSW 1 136468279 missense probably benign
R1730:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1730:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1730:Kif14 UTSW 1 136490332 missense probably benign
R1730:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1730:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1730:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1739:Kif14 UTSW 1 136468279 missense probably benign
R1739:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1739:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1739:Kif14 UTSW 1 136490332 missense probably benign
R1739:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1739:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1739:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1762:Kif14 UTSW 1 136468279 missense probably benign
R1762:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1762:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1762:Kif14 UTSW 1 136490332 missense probably benign
R1762:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1762:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1762:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1783:Kif14 UTSW 1 136468279 missense probably benign
R1783:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1783:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1783:Kif14 UTSW 1 136490332 missense probably benign
R1783:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1783:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1783:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1784:Kif14 UTSW 1 136468279 missense probably benign
R1784:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1784:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1784:Kif14 UTSW 1 136490332 missense probably benign
R1784:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1784:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1784:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1785:Kif14 UTSW 1 136468279 missense probably benign
R1785:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1785:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1785:Kif14 UTSW 1 136490332 missense probably benign
R1785:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1785:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1785:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1872:Kif14 UTSW 1 136486358 missense probably damaging 1.00
R2049:Kif14 UTSW 1 136487080 missense probably benign
R2049:Kif14 UTSW 1 136510167 missense possibly damaging 0.68
R2268:Kif14 UTSW 1 136519748 nonsense probably null
R2373:Kif14 UTSW 1 136479845 missense probably damaging 1.00
R3076:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3077:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3078:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R4232:Kif14 UTSW 1 136516363 nonsense probably null
R4246:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4247:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4250:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4672:Kif14 UTSW 1 136521278 missense probably benign 0.00
R4672:Kif14 UTSW 1 136521279 missense probably benign
R4890:Kif14 UTSW 1 136487130 missense possibly damaging 0.91
R4994:Kif14 UTSW 1 136482959 missense probably damaging 1.00
R5102:Kif14 UTSW 1 136516403 missense probably benign 0.00
R5185:Kif14 UTSW 1 136527469 nonsense probably null
R5201:Kif14 UTSW 1 136503407 missense probably benign 0.00
R5399:Kif14 UTSW 1 136503324 missense probably benign 0.00
R5431:Kif14 UTSW 1 136496695 missense possibly damaging 0.91
R5932:Kif14 UTSW 1 136516390 missense probably benign 0.23
R6027:Kif14 UTSW 1 136483059 intron probably null
R6246:Kif14 UTSW 1 136476424 nonsense probably null
R6331:Kif14 UTSW 1 136515986 missense probably null 1.00
R6448:Kif14 UTSW 1 136503347 missense probably damaging 0.99
R6453:Kif14 UTSW 1 136482304 intron probably null
R6475:Kif14 UTSW 1 136527411 missense probably damaging 1.00
R6631:Kif14 UTSW 1 136515959 missense probably benign 0.39
R6713:Kif14 UTSW 1 136525806 missense probably benign
R7173:Kif14 UTSW 1 136479170 missense probably damaging 0.98
R7174:Kif14 UTSW 1 136521257 missense possibly damaging 0.67
R7241:Kif14 UTSW 1 136468753 missense probably benign 0.41
X0021:Kif14 UTSW 1 136490276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACTTAACGGGAAAACCTTCAG -3'
(R):5'- CTCTCCTGCACGAGGAAAAGTGAC -3'

Sequencing Primer
(F):5'- GGTCCCTGTTACTTAAAAGACTTGC -3'
(R):5'- TCATGGACGGTCTCCAAGTG -3'
Posted On2013-07-11