Incidental Mutation 'R7666:Olfr1328'
ID591920
Institutional Source Beutler Lab
Gene Symbol Olfr1328
Ensembl Gene ENSMUSG00000111259
Gene Nameolfactory receptor 1328
SynonymsOlfr1519, MOR259-1, MOR259-13, MOR259-1, GA_x6K02T2QD9B-18602750-18603691
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7666 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118930071-118938612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118934264 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 195 (T195S)
Ref Sequence ENSEMBL: ENSMUSP00000149039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081960] [ENSMUST00000215312]
Predicted Effect probably damaging
Transcript: ENSMUST00000081960
AA Change: T193S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080626
Gene: ENSMUSG00000111259
AA Change: T193S

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 36 306 9.1e-8 PFAM
Pfam:7tm_1 42 291 1.7e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215312
AA Change: T195S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 G A 4: 139,633,957 V72M probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atl3 T C 19: 7,510,040 S107P probably benign Het
Brpf3 T C 17: 28,810,572 L502P possibly damaging Het
C6 T A 15: 4,789,505 S440T probably damaging Het
Car3 A G 3: 14,870,064 H177R probably benign Het
Ccdc148 A G 2: 58,934,500 W310R probably damaging Het
Cchcr1 C T 17: 35,526,486 T401I probably benign Het
Cdk13 G A 13: 17,772,576 probably benign Het
Celsr2 A G 3: 108,398,588 S2067P probably benign Het
Chrng A T 1: 87,209,453 T278S probably benign Het
Clec14a T A 12: 58,267,757 T360S probably benign Het
Cr2 A G 1: 195,154,225 Y877H probably damaging Het
Crybg3 A T 16: 59,559,337 L518* probably null Het
Cyp2c38 A T 19: 39,438,242 V205D possibly damaging Het
Dlg5 G A 14: 24,157,799 P1113L probably damaging Het
Dnah7a A T 1: 53,547,297 V1465E probably benign Het
Fbn1 C T 2: 125,306,471 C2619Y probably damaging Het
Fbxl4 A G 4: 22,376,869 T102A probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gimap8 A C 6: 48,659,155 N618T probably damaging Het
Gk5 T A 9: 96,153,107 F286L probably damaging Het
Gm13078 A T 4: 143,728,515 Y461F probably benign Het
Gucy2c G A 6: 136,697,968 S1039L probably benign Het
Hmcn2 C T 2: 31,380,233 P1161S probably damaging Het
Hnrnpa2b1 A T 6: 51,466,937 V78E possibly damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ltbp3 C T 19: 5,747,006 S387L possibly damaging Het
Mrpl48 A G 7: 100,565,201 V64A probably benign Het
Muc16 T C 9: 18,558,427 Y7284C probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myh4 A T 11: 67,256,281 D1584V probably damaging Het
Myl7 A G 11: 5,897,140 F138L possibly damaging Het
Nek5 T C 8: 22,090,517 K395R probably benign Het
Olfr1448 A G 19: 12,920,162 L49P probably damaging Het
Olfr720 A T 14: 14,176,075 D2E probably benign Het
Phf7 C T 14: 31,240,354 E165K probably damaging Het
Pnpla6 A G 8: 3,541,591 Y1213C probably benign Het
Ppp1r9a A T 6: 5,143,238 K1005N probably benign Het
Ppp2r3d A T 9: 124,440,873 D8E probably damaging Het
Ptprn2 C A 12: 116,841,320 R152S probably benign Het
Smc5 A T 19: 23,229,017 D724E probably benign Het
Snx30 T C 4: 59,885,047 V229A probably benign Het
Spata31d1c A C 13: 65,036,000 N452T probably benign Het
Tacc2 C T 7: 130,716,814 probably benign Het
Thsd7a C T 6: 12,379,438 D996N Het
Tubb2b A G 13: 34,128,135 L225P probably damaging Het
Ubr4 A G 4: 139,413,480 T1237A possibly damaging Het
Unc50 G A 1: 37,431,415 R40Q possibly damaging Het
Usp31 T C 7: 121,649,181 E1013G possibly damaging Het
Vwa5a A G 9: 38,733,963 D448G probably benign Het
Wnt5a T C 14: 28,518,372 S160P possibly damaging Het
Zfp618 T A 4: 63,132,717 Y578* probably null Het
Zfp804a C T 2: 82,259,060 Q1078* probably null Het
Zfp808 C T 13: 62,171,411 T131M probably benign Het
Other mutations in Olfr1328
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr1328 APN 4 118934161 missense probably damaging 1.00
IGL02685:Olfr1328 APN 4 118933937 missense possibly damaging 0.61
IGL02886:Olfr1328 APN 4 118934830 missense probably benign
IGL02899:Olfr1328 APN 4 118934662 missense probably damaging 1.00
IGL02957:Olfr1328 APN 4 118934119 missense probably damaging 1.00
PIT4453001:Olfr1328 UTSW 4 118934626 missense probably benign
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R1158:Olfr1328 UTSW 4 118934417 missense probably damaging 1.00
R1450:Olfr1328 UTSW 4 118934510 missense probably benign 0.01
R1682:Olfr1328 UTSW 4 118934581 missense probably damaging 1.00
R1978:Olfr1328 UTSW 4 118934184 nonsense probably null
R2363:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2364:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2365:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2507:Olfr1328 UTSW 4 118933925 missense probably benign
R2912:Olfr1328 UTSW 4 118934701 missense probably benign 0.28
R3937:Olfr1328 UTSW 4 118934683 missense probably damaging 1.00
R4058:Olfr1328 UTSW 4 118934683 missense probably damaging 1.00
R4089:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4090:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4419:Olfr1328 UTSW 4 118934389 missense possibly damaging 0.56
R4717:Olfr1328 UTSW 4 118934429 missense probably benign 0.45
R5570:Olfr1328 UTSW 4 118934066 missense possibly damaging 0.88
R5591:Olfr1328 UTSW 4 118934461 missense probably damaging 1.00
R6149:Olfr1328 UTSW 4 118934431 missense probably damaging 1.00
R7202:Olfr1328 UTSW 4 118934018 missense probably benign
R7214:Olfr1328 UTSW 4 118933949 missense possibly damaging 0.88
R7391:Olfr1328 UTSW 4 118934001 missense possibly damaging 0.61
R7676:Olfr1328 UTSW 4 118934150 missense probably damaging 1.00
R8053:Olfr1328 UTSW 4 118934111 missense probably damaging 1.00
Z1176:Olfr1328 UTSW 4 118933918 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TAGCTGGAGTTGGGCCTAAG -3'
(R):5'- GCGCTATACTGTCATCCTTAACTG -3'

Sequencing Primer
(F):5'- CCTAAGGTAGATGTAAGTGGCTG -3'
(R):5'- CCTTAACTGGGGCTTGTGCATAC -3'
Posted On2019-11-12